National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32311R-1 
 Symbol zormin  Full Name zormin 
 CG No CG33484  Old CG No CG32311 
 Synonyms CG5699, CT36990, CG32311, CG32310, CG32307, CG32309, CG11952, CG11953, CG1282, CG11850, CG33484, BcDNA:GH09541, zormin 
 Accession No (Link to NCBI) NM_206240.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAGCAGGAGCAGCGCCAGAA 
 Primer Seq. 3'
aatctagaggtaccGGTCCACTTGATCGCGTAGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAAGCAGGAG CAGCNCCAGA AGGAGCAAAG GGAGCGGGAT GCTCGTGACC AAGCCGAACG 
0061 GGAAAAGGCT ATAAAGGAAG CAGAGGCCAA GGAAAGGTTG CACAGAGAAG AGCAATCCCG 
0121 CCTAGAAAAC CAGCGCCAGC AGGCGGCCAT TGAGCAGGCT CAACGGGAAT TGGCAGCCAG 
0181 AGAATTGGCT CTGAGGGAGC AAGCTGTCCG GGAGGAGGAG GCCAGATTGC AGGCCATTCG 
0241 GGAGCAGGCC ACGCGGGAAC AATTGGCCAG GGAACAGGCT GCCCGGGAGG AGGAGCTGCG 
0301 TATACAATCG CTCAGAGATA TTGCTCGCAG GGAAGAGGAA GTGCGTCTCC AAAACATCAG 
0361 GGATGAGGAA ACCCGCATTC GCCGCGAGGA GGAGGAGCGT ATCCGTAGAG AAAACGAGTC 
0421 ACGATCGAAA CGAGAGGAGG AGGCCCGCAT CCAGCGTGAG GAGATCACCA GACTCCAAAC 
0481 CCTACGCGAT CAATGTGGAC C 
 in silico PCR Fragment
0001 GAAGCAGGAG CAGCGCCAGA AGGAGCAAAG GGAGCGGGAT GCTCGTGATC AAGCCGAACG 
0061 GGAAAAGGCT ATAAAGGAAG CAGAGGCCAA GGAAAGGTTG CACAGAGAAG AGCAATCCCG 
0121 ACTAGAAAAC CAGCGCCAGC AGGCGGCCAT TGAGCAGGCT CAACGGGAAT TGGCAGCCAG 
0181 AGAATTGGCT CTGAGGGAGC AAGCTGTCCG GGAGGAGGAG GCCAGATTGC AGGCCATTCG 
0241 GGAGCAGGCC ACGCGGGAAC AATTGGCCAG GGAACAGGCT GCCCGGGAGG AGGAGCTGCG 
0301 TATACAATCG CTCAGAGATA TTGCCCGCAG GGAAGAGGAA GTGCGTCTCC AAAACATCAG 
0361 GGATGAAGAA ACCCGCATTC GCCGCGAGGA GGAGGAGCGT ATCCGTAGAG AAAACGAGTC 
0421 ACGATCGAAA CGAGAGGAGG AAGCCCGCAT CCAGCGTGAG GAGATCACCA GACTCCAGAC 
0481 CCTACGCGAT CAA-GTGGAC C 
 Assemble Data

32311R-1.IR_full        1   AAGCAGGAGCAGCNCCAGAAGGAGCAAAGGGAGCGGGATGCTCGTGACCAAGCCGAACG 59
                            ||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||
32311R-1.in silico      1   AAGCAGGAGCAGCGCCAGAAGGAGCAAAGGGAGCGGGATGCTCGTGATCAAGCCGAACG 59


32311R-1.IR_full       61  GGAAAAGGCTATAAAGGAAGCAGAGGCCAAGGAAAGGTTGCACAGAGAAGAGCAATCCCG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32311R-1.in silico     61  GGAAAAGGCTATAAAGGAAGCAGAGGCCAAGGAAAGGTTGCACAGAGAAGAGCAATCCCG 119


32311R-1.IR_full       121 CCTAGAAAACCAGCGCCAGCAGGCGGCCATTGAGCAGGCTCAACGGGAATTGGCAGCCAG 179
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32311R-1.in silico     121 ACTAGAAAACCAGCGCCAGCAGGCGGCCATTGAGCAGGCTCAACGGGAATTGGCAGCCAG 179


32311R-1.IR_full       181 AGAATTGGCTCTGAGGGAGCAAGCTGTCCGGGAGGAGGAGGCCAGATTGCAGGCCATTCG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32311R-1.in silico     181 AGAATTGGCTCTGAGGGAGCAAGCTGTCCGGGAGGAGGAGGCCAGATTGCAGGCCATTCG 239


32311R-1.IR_full       241 GGAGCAGGCCACGCGGGAACAATTGGCCAGGGAACAGGCTGCCCGGGAGGAGGAGCTGCG 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32311R-1.in silico     241 GGAGCAGGCCACGCGGGAACAATTGGCCAGGGAACAGGCTGCCCGGGAGGAGGAGCTGCG 299


32311R-1.IR_full       301 TATACAATCGCTCAGAGATATTGCTCGCAGGGAAGAGGAAGTGCGTCTCCAAAACATCAG 359
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
32311R-1.in silico     301 TATACAATCGCTCAGAGATATTGCCCGCAGGGAAGAGGAAGTGCGTCTCCAAAACATCAG 359


32311R-1.IR_full       361 GGATGAGGAAACCCGCATTCGCCGCGAGGAGGAGGAGCGTATCCGTAGAGAAAACGAGTC 419
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
32311R-1.in silico     361 GGATGAAGAAACCCGCATTCGCCGCGAGGAGGAGGAGCGTATCCGTAGAGAAAACGAGTC 419


32311R-1.IR_full       421 ACGATCGAAACGAGAGGAGGAGGCCCGCATCCAGCGTGAGGAGATCACCAGACTCCAAAC 479
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||
32311R-1.in silico     421 ACGATCGAAACGAGAGGAGGAAGCCCGCATCCAGCGTGAGGAGATCACCAGACTCCAGAC 479


32311R-1.IR_full       481 CCTACGCGATCAATGTGGACC 500
                           ||||||||||||| |||||||
32311R-1.in silico     481 CCTACGCGATCAA-GTGGACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  33  NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
100   482  33  NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
100   482  33  NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
100   482  32  NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0.41   NM_057657.4  CG17158-RA (cpb), mRNA 
0.41   NM_057269.2  CG10236-RA (LanA), mRNA 
0.2   NM_140447.1  CG9598-RA (CG9598), mRNA 
0.2   NM_164746.1  CG4889-RB, transcript variant B (wg), mRNA 
0.2   NM_078778.3  CG4889-RA, transcript variant A (wg), mRNA 
0   NM_167963.1  CG32297-RA (CG32297), mRNA 
0   NM_057631.4  CG5786-RA (ppan), mRNA 
0   NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   NM_001038747.1  CG32717-RF, transcript variant F (sdt), mRNA 
0   NM_206652.1  CG32717-RD, transcript variant D (sdt), mRNA 
0   NM_001042798.1  CG32717-RH, transcript variant H (sdt), mRNA 
0   NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   NM_164715.1  CG32828-RA (CG32828), mRNA 
0   NM_142135.1  CG14857-RA (CG14857), mRNA 
0   NM_140989.1  CG13251-RA (CG13251), mRNA 
0   NM_176736.1  CG15643-RA (CG15643), mRNA 
0   20  NM_166535.1  CG4444-RA (px), mRNA 
0   NM_143812.2  CG7480-RA (Pgant35A), mRNA 
0   NM_206667.1  CG10701-RG, transcript variant G (Moe), mRNA 
0   NM_206668.1  CG10701-RF, transcript variant F (Moe), mRNA 
0   NM_206666.1  CG10701-RH, transcript variant H (Moe), mRNA 
0   NM_206669.1  CG10701-RE, transcript variant E (Moe), mRNA 
0   NM_206665.1  CG10701-RI, transcript variant I (Moe), mRNA 
0   NM_206664.1  CG10701-RJ, transcript variant J (Moe), mRNA 
0   NM_167170.1  CG10701-RC, transcript variant C (Moe), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.