National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32309R-1 
 Symbol zormin  Full Name zormin 
 CG No CG33484  Old CG No CG32309 
 Synonyms CG5699, CT36990, CG32311, CG32310, CG32307, CG32309, CG11952, CG11953, CG1282, CG11850, CG33484, BcDNA:GH09541, zormin 
 Accession No (Link to NCBI) NM_206240.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCCAGGTGGACACACAGTTG 
 Primer Seq. 3'
aatctagaggtaccTCGGTGTCGATTTCGCGGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCCAGGTGG ACACACAGTT GTATCCCGTA TTCACCTCCC AGAGCGTGGA CTCCAAGCAG 
0061 CTGCTGATCA GCACCCGCGA GAAGCTGACC AACGTGATCC AGGATATCGA AAGGGCCCAA 
0121 GATGAGATAC AGCAGCGCAT CCAGACCACA CTCGGCATCC AGACCAAGGA TCAGCCATCG 
0181 CTGGCCAAGA TCGAGCAGGT GATCAACAAC CTGCGCATGC TGNAAGGCCA AGTTGGACGG 
0241 CATCAAGTAC NGACTATCGC ACTTTGGTGG AGAGCGTAAT TCAGTTCTTG GAGAACATAG 
0301 TGCAGCTGCG GCGCGAAATC GACGACTACT TCGCCAGGCA ACAGAAGGAA CCCGCATCCG 
0361 GCGCGGATCG CAGCATCGTG GAGCACGAGA AATTCCGCGA TCAGTGCATG GATAAATTTA 
0421 GATCGCTAAT CACACAATCC GAACTGCTGA TCGATCGGGT GCGCGTACTG GAACCGCCGG 
0481 GAGCCCGCGA AATCGACACC GA 
 in silico PCR Fragment
0001 ACCCAGGTGG ACACACAGTT GTATCCCGTA TTCACGTCCC AGAGCGTGGA CTCCAAGCAG 
0061 CTGCTGATCA GCACCCGCGA GAAGCTGACC AACGTGATCC AGGATATCGA AAGGGCCCAA 
0121 GATGAGATAC AGCAGCGCAT CCAGACCACG CTCGGCATCC AGACCAAGGA TCAGCCATCG 
0181 CTGGCCAAGA TCGAGCAGGT GATCAACAAC CTGCGCATGC TG-AAGGCCA AGTTGGACGG 
0241 CATCAAGTAC -GACTATCGC ACTTTGGTGG AGAGCGTAAT TCAGTTCCTG GAGAACATAG 
0301 TGCAGCTGCG GCGCGAAATC GACGACTACT TCGCCAGGCA ACAGAAGGAA CCCGCATCCG 
0361 GCGCGGATCG CAGCATCGCG GAGCACGAGA AATTCCGCGA TCAGTGCATG GATAAATTTA 
0421 GATCGCTAAT CACACAATCC GAACTGCTGA TCGATCGGGT GCGCGTACTG GAACCGCCGG 
0481 GAGCCCGCGA AATCGACACC GA 
 Assemble Data

32309R-1.IR_full       1   ACCCAGGTGGACACACAGTTGTATCCCGTATTCACCTCCCAGAGCGTGGACTCCAAGCAG 60
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
32309R-1.in silico     1   ACCCAGGTGGACACACAGTTGTATCCCGTATTCACGTCCCAGAGCGTGGACTCCAAGCAG 60


32309R-1.IR_full       61  CTGCTGATCAGCACCCGCGAGAAGCTGACCAACGTGATCCAGGATATCGAAAGGGCCCAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32309R-1.in silico     61  CTGCTGATCAGCACCCGCGAGAAGCTGACCAACGTGATCCAGGATATCGAAAGGGCCCAA 120


32309R-1.IR_full       121 GATGAGATACAGCAGCGCATCCAGACCACACTCGGCATCCAGACCAAGGATCAGCCATCG 180
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
32309R-1.in silico     121 GATGAGATACAGCAGCGCATCCAGACCACGCTCGGCATCCAGACCAAGGATCAGCCATCG 180


32309R-1.IR_full       181 CTGGCCAAGATCGAGCAGGTGATCAACAACCTGCGCATGCTGNAAGGCCAAGTTGGACGG 240
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
32309R-1.in silico     181 CTGGCCAAGATCGAGCAGGTGATCAACAACCTGCGCATGCTG-AAGGCCAAGTTGGACGG 240


32309R-1.IR_full       241 CATCAAGTACNGACTATCGCACTTTGGTGGAGAGCGTAATTCAGTTCTTGGAGAACATAG 300
                           |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||
32309R-1.in silico     241 CATCAAGTAC-GACTATCGCACTTTGGTGGAGAGCGTAATTCAGTTCCTGGAGAACATAG 300


32309R-1.IR_full       301 TGCAGCTGCGGCGCGAAATCGACGACTACTTCGCCAGGCAACAGAAGGAACCCGCATCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32309R-1.in silico     301 TGCAGCTGCGGCGCGAAATCGACGACTACTTCGCCAGGCAACAGAAGGAACCCGCATCCG 360


32309R-1.IR_full       361 GCGCGGATCGCAGCATCGTGGAGCACGAGAAATTCCGCGATCAGTGCATGGATAAATTTA 420
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
32309R-1.in silico     361 GCGCGGATCGCAGCATCGCGGAGCACGAGAAATTCCGCGATCAGTGCATGGATAAATTTA 420


32309R-1.IR_full       421 GATCGCTAATCACACAATCCGAACTGCTGATCGATCGGGTGCGCGTACTGGAACCGCCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32309R-1.in silico     421 GATCGCTAATCACACAATCCGAACTGCTGATCGATCGGGTGCGCGTACTGGAACCGCCGG 480


32309R-1.IR_full       481 GAGCCCGCGAAATCGACACCGA 502
                           ||||||||||||||||||||||
32309R-1.in silico     481 GAGCCCGCGAAATCGACACCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
100   482  11  NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
100   482  11  NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
100   482  11  NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_142565.2  CG6195-RA (CG6195), mRNA 
0   NM_166072.1  CG10205-RA, transcript variant A (CG10205), mRNA 
0   NM_137149.2  CG10205-RB, transcript variant B (CG10205), mRNA 
0   NM_132559.1  CG2750-RA (CG2750), mRNA 
0   NM_132722.2  CG1434-RA (CG1434), mRNA 
0   NM_079126.2  CG3616-RA (Cyp9c1), mRNA 
0   NM_137334.2  CG6805-RA (CG6805), mRNA 
0   NM_136786.2  CG11979-RA (Rpb5), mRNA 
0   NM_170196.1  CG31112-RA (CG31112), mRNA 
0   NM_140475.1  CG10006-RA (CG10006), mRNA 
0   NM_079279.2  CG3431-RA (Uch-L3), mRNA 
0   NM_139591.2  CG11594-RB, transcript variant B (CG11594), mRNA 
0   NM_168046.1  CG11594-RA, transcript variant A (CG11594), mRNA 
0   NM_168047.1  CG11594-RC, transcript variant C (CG11594), mRNA 
0   NM_079983.2  CG9415-RA, transcript variant A (Xbp1), mRNA 
0   NM_166427.2  CG9415-RB, transcript variant B (Xbp1), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_142425.2  CG7212-RA (cdm), mRNA 
0   NM_137864.1  CG30259-RA (CG30259), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_080329.2  CG3697-RA (mei-9), mRNA 
0   NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   NM_168711.2  CG6664-RD, transcript variant D (CG6664), mRNA 
0   NM_168709.3  CG6664-RB, transcript variant B (CG6664), mRNA 
0   NM_168710.3  CG6664-RC, transcript variant C (CG6664), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.