National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3228R-3 
 Symbol kz  Full Name kurz 
 CG No CG3228  Old CG No CG3228 
 Synonyms EG:30B8.2, CG3228, l67, N8, N1, l(1)N4, l(1)2Eb, kz 
 Accession No (Link to NCBI) NM_057243.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGTGAAGAAGATTCAGATCG 
 Primer Seq. 3'
aatctagaggtaccTTCGTCATCTTCCTCCACGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGTGNAAGA AGATTCAGAT CGATGTGGAT GCTGTgGNCG GCGGCAACCA GGTTGGCTAC 
0061 GATGAGGCCA ACGCTCTGGT TCTGCCCTCC GAGAAGCGGG CCACCAAGAT TAAGGTGGAC 
0121 AAAGTGCAAC ACGTGAAGAT CCTTTCCAAG AAGCAGCGCA AGCACCTCCA GGCTATTGTG 
0181 GACAAGAAGA AAAAGAAAGA GGGTCGCGCT CAGCTGTTGG GTGACCTTGC TGCCGTTCAA 
0241 ATTCCGGAGG AGGAGCTGCA GCAGTATACT TCCATTAGCC AAGTGCAAAC CGTGGGATTA 
0301 AAGCGTCTAC CCACCCTTGA CGAGTATCTA GCCAAGAAAA AGGAAAGACA GGCCCAAGTT 
0361 CTAGCTGAAA AAAGCTCGGC GTCGGGTCTC CGCGTAAATG CTATAAAGGG CTCCAAGCGC 
0421 AAGCTTCNTC GTCGAAGAGG AGGAAGAACT ACAGGCCAAG CGAAAGAATC CGAATGTAAT 
0481 TAGCGTGGAG GAAGATGACG AA 
 in silico PCR Fragment
0001 CCGTG-AAGA AGATTCAGAT CGATGTGGAT GCTGTGGCCG GCGGCAACCA GGTTGGCTAC 
0061 GATGAGGCCA ACGCTCTGGT TCTGCCCTCC GAGAAGCGGG CCACCAAGAT TAAGGTGGAC 
0121 AAAGTGCAAC ACGTGAAGAT CCTTTCCAAG AAGCAGCGCA AGCACCTCCA GGCTATTGTG 
0181 GACAAGAAGA AAAAGAAAGA GGGTCGCGCT CAGCTGTTGG GTGACCTTGC TGCCGTTCAA 
0241 ATTCCGGAGG AGGAGCTGCA GCAGTATACT TCCATTAGCC AAGTGCAAAC CGTGGGATTA 
0301 AAGCGTCTAC CCACCCTTGA CGAGTATCTA GCCAAGAAAA AGGAAAGACA GGCCCAAGTT 
0361 TTAGCTGAAA AAAGCTCGGC GTCGGGTCTC CGCGTAAATG CTATAAAGGG CTCCAAGCGC 
0421 AAGCTTC-TC GTCGAAGAGG AGGAGGAACT ACAGGCCAAG CGAAAGAATC CGAATGTAAT 
0481 TAGCGTGGAG GAAGATGACG AA 
 Assemble Data

3228R-3.IR_full       1   CCGTGNAAGAAGATTCAGATCGATGTGGATGCTGTGGNCGGCGGCAACCAGGTTGGCTAC 60
                          ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||
3228R-3.in silico     1   CCGTG-AAGAAGATTCAGATCGATGTGGATGCTGTGGCCGGCGGCAACCAGGTTGGCTAC 60


3228R-3.IR_full       61  GATGAGGCCAACGCTCTGGTTCTGCCCTCCGAGAAGCGGGCCACCAAGATTAAGGTGGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     61  GATGAGGCCAACGCTCTGGTTCTGCCCTCCGAGAAGCGGGCCACCAAGATTAAGGTGGAC 120


3228R-3.IR_full       121 AAAGTGCAACACGTGAAGATCCTTTCCAAGAAGCAGCGCAAGCACCTCCAGGCTATTGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     121 AAAGTGCAACACGTGAAGATCCTTTCCAAGAAGCAGCGCAAGCACCTCCAGGCTATTGTG 180


3228R-3.IR_full       181 GACAAGAAGAAAAAGAAAGAGGGTCGCGCTCAGCTGTTGGGTGACCTTGCTGCCGTTCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     181 GACAAGAAGAAAAAGAAAGAGGGTCGCGCTCAGCTGTTGGGTGACCTTGCTGCCGTTCAA 240


3228R-3.IR_full       241 ATTCCGGAGGAGGAGCTGCAGCAGTATACTTCCATTAGCCAAGTGCAAACCGTGGGATTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     241 ATTCCGGAGGAGGAGCTGCAGCAGTATACTTCCATTAGCCAAGTGCAAACCGTGGGATTA 300


3228R-3.IR_full       301 AAGCGTCTACCCACCCTTGACGAGTATCTAGCCAAGAAAAAGGAAAGACAGGCCCAAGTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     301 AAGCGTCTACCCACCCTTGACGAGTATCTAGCCAAGAAAAAGGAAAGACAGGCCCAAGTT 360


3228R-3.IR_full       361 CTAGCTGAAAAAAGCTCGGCGTCGGGTCTCCGCGTAAATGCTATAAAGGGCTCCAAGCGC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3228R-3.in silico     361 TTAGCTGAAAAAAGCTCGGCGTCGGGTCTCCGCGTAAATGCTATAAAGGGCTCCAAGCGC 420


3228R-3.IR_full       421 AAGCTTCNTCGTCGAAGAGGAGGAAGAACTACAGGCCAAGCGAAAGAATCCGAATGTAAT 480
                          ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||
3228R-3.in silico     421 AAGCTTC-TCGTCGAAGAGGAGGAGGAACTACAGGCCAAGCGAAAGAATCCGAATGTAAT 480


3228R-3.IR_full       481 TAGCGTGGAGGAAGATGACGAA 502
                          ||||||||||||||||||||||
3228R-3.in silico     481 TAGCGTGGAGGAAGATGACGAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057243.3  CG3228-RA (kz), mRNA 
0.2   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0.2   NM_130550.2  CG11417-RA (CG11417), mRNA 
0.2   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_078653.1  CG18572-RA, transcript variant A (r), mRNA 
0   NM_206765.1  CG18572-RB, transcript variant B (r), mRNA 
0   NM_143024.2  CG13630-RA (CG13630), mRNA 
0   NM_079389.2  CG4109-RA (Syx8), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 
0   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_169601.1  CG7425-RA (eff), mRNA 
0   NM_167188.1  CG32703-RA (CG32703), mRNA 
0   NM_079864.2  CG1470-RA (Gycbeta100B), mRNA 
0   10  NM_141658.3  CG8301-RA (CG8301), mRNA 
0   10  NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   12  NM_135861.1  CG15287-RA (CG15287), mRNA 
0   10  NM_136200.2  CG2478-RA (CG2478), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_167133.1  CG2175-RC, transcript variant C (dec-1), mRNA 
0   NM_167132.1  CG2175-RB, transcript variant B (dec-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.