National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3228R-1 
 Symbol kz  Full Name kurz 
 CG No CG3228  Old CG No CG3228 
 Synonyms EG:30B8.2, CG3228, l67, N8, N1, l(1)N4, l(1)2Eb, kz 
 Accession No (Link to NCBI) NM_057243.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     1   CCGTG-AAGAAGATTCAGATCGATGTGGATGCTGTGGCCGGCGGCAACCAGGTTGGCTAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATGAGGCCAACGCTCTGGTTCTGCCCTCCGAGAAGCGGGCCACCAAGATTAAGGTGGAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAAGTGCAACACGTGAAGATCCTTTCCAAGAAGCAGCGCAAGCACCTCCAGGCTATTGTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACAAGAAGAAAAAGAAAGAGGGTCGCGCTCAGCTGTTGGGTGACCTTGCTGCCGTTCAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTCCGGAGGAGGAGCTGCAGCAGTATACTTCCATTAGCCAAGTGCAAACCGTGGGATTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAGCGTCTACCCACCCTTGACGAGTATCTAGCCAAGAAAAAGGAAAGACAGGCCCAAGTT 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTAGCTGAAAAAAGCTCGGCGTCGGGTCTCCGCGTAAATGCTATAAAGGGCTCCAAGCGC 420

                          ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     421 AAGCTTC-TCGTCGAAGAGGAGGAGGAACTACAGGCCAAGCGAAAGAATCCGAATGTAAT 480

3228R-1.IR_full       481 TAGCGTGGAGGAAGATGACGAA 502
                          |||||||||||||||||||||| silico     481 TAGCGTGGAGGAAGATGACGAA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.