National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3227R-2 
 Symbol insv  Full Name insensitive 
 CG No CG3227  Old CG No CG3227 
 Synonyms CG3227, BcDNA:RE55538, insv 
 Accession No (Link to NCBI) NM_134846.2 
 Inserted Chr. ll 
 Insertional Mutation  3 semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     1   AGGAGGAGCAAGCCCTTGTTTCTGAATGCCTGGTCGCAGACTTCTAGCGTGGACTTC-GA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGTGCTTCGCAGCATCTCCGCGCCGGACCCGCAAGTGGAGGTCGAGAACAGAGCGCTCCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGATAAGGTCCGCTACTTGGAGGCCAAACTGCAGCAGCACAAGGATCTGCTATCCCAGAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCATGCCACCTCCGCCAGGATGCAACAGGCATCCTCCCTGCTGGCAGAAAGTAGACCACC 240

                          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     241 CACGCCGCCCGCGGTCC-AGAGCCACCACATTCTCACGCCACCGAGTTCAGAGATATGTG 300

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCCCGCGCAG-AATCCCCAGATTCTGGACTACAAGATCATCTCGGCACCCGACGATGCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGCCATTGAGATTCGCCTGGCGGCGGAGAGTCTGAACAGCCTGAGCACCTCTGCGGAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAGATCGCCTGGAGATTTGCCTGGGCGACGAGAATCATCAGCAGAGCAATCATCACAAT 480

3227R-2.IR_full       481 TCCCAGCAGCAGTACAGGATTNAG 504
                          ||||||||||||||||||||| || silico     481 TCCCAGCAGCAGTACAGGATT-AG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134846.2  CG3227-RA (insv), mRNA 
0.62   NM_079230.2  CG32386-RA (corn), mRNA 
0.2   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_132991.1  CG12432-RA (CG12432), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0   NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0   NM_132100.3  CG10695-RA (Pat1), mRNA 
0   NM_135777.1  CG16813-RA (CG16813), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_135891.3  CG4140-RA (CG4140), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   13  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0   NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0   NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0   NM_140872.1  CG9330-RA (CG9330), mRNA 
0   NM_078769.2  CG11181-RA (cup), mRNA 
0   NM_163890.1  CG32491-RE, transcript variant E (mod(mdg4)), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_140510.2  CG7275-RA (CG7275), mRNA 
0   NM_163886.1  CG32491-RP, transcript variant P (mod(mdg4)), mRNA 
0   NM_163885.1  CG32491-RJ, transcript variant J (mod(mdg4)), mRNA 
0   NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.