National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3227R-1 
 Symbol insv  Full Name insensitive 
 CG No CG3227  Old CG No CG3227 
 Synonyms CG3227, BcDNA:RE55538, insv 
 Accession No (Link to NCBI) NM_134846.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGGAGCAAGCCCTTGTTT 
 Primer Seq. 3'
aatctagaggtaccCTAATCCTGTACTGCTGCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGGAGCA AGCCCTTGTT TCTGAATGCC TGGTCGCAGA cTTCTAGCGT GGACTTCNGA 
0061 GGTGCTTCGC AGCATCTCCG CGCCGGACCC GCAAGTGGAG GTCGAGAACA GAGCGCTCCG 
0121 CGATAAGGTC CGCTACTTGG AGGCCAAACT GCAGCAGCAC AAGGATCTGC TATCCCAGAT 
0181 TCATGCCACC TCCGCCAGGA TGCAACAGGC ATCCTCCCTG CTGGCAGAAA GTAGACCACC 
0241 CACGCCGCCC GCGGTCCNAG AGCCACCACA TTCTCACGCC ACCGAGTTCA GAGATATGTG 
0301 CGCCCGCGCA GNAATCCCCA GATTCTGGAC TACAAGATCA TCTCGGCACC CGACGATGCG 
0361 GATGCCATTG AGATTCGCCT GGCGGCGGAG AGTCTGAACA GCCTGAGCAC CTCTGCGGAC 
0421 TCAGATCGCC TGGAGATTTG CCTGGGCGAC GAGAATCATC AGCAGAGCAA TCATCACAAT 
0481 TCCCAGCAGC AGTACAGGAT TNAG 
 in silico PCR Fragment
0001 AGGAGGAGCA AGCCCTTGTT TCTGAATGCC TGGTCGCAGA CTTCTAGCGT GGACTTC-GA 
0061 GGTGCTTCGC AGCATCTCCG CGCCGGACCC GCAAGTGGAG GTCGAGAACA GAGCGCTCCG 
0121 CGATAAGGTC CGCTACTTGG AGGCCAAACT GCAGCAGCAC AAGGATCTGC TATCCCAGAT 
0181 TCATGCCACC TCCGCCAGGA TGCAACAGGC ATCCTCCCTG CTGGCAGAAA GTAGACCACC 
0241 CACGCCGCCC GCGGTCC-AG AGCCACCACA TTCTCACGCC ACCGAGTTCA GAGATATGTG 
0301 CGCCCGCGCA G-AATCCCCA GATTCTGGAC TACAAGATCA TCTCGGCACC CGACGATGCG 
0361 GATGCCATTG AGATTCGCCT GGCGGCGGAG AGTCTGAACA GCCTGAGCAC CTCTGCGGAC 
0421 TCAGATCGCC TGGAGATTTG CCTGGGCGAC GAGAATCATC AGCAGAGCAA TCATCACAAT 
0481 TCCCAGCAGC AGTACAGGAT T-AG 
 Assemble Data

3227R-1.IR_full       1   AGGAGGAGCAAGCCCTTGTTTCTGAATGCCTGGTCGCAGACTTCTAGCGTGGACTTCNGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
3227R-1.in silico     1   AGGAGGAGCAAGCCCTTGTTTCTGAATGCCTGGTCGCAGACTTCTAGCGTGGACTTC-GA 60


3227R-1.IR_full       61  GGTGCTTCGCAGCATCTCCGCGCCGGACCCGCAAGTGGAGGTCGAGAACAGAGCGCTCCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     61  GGTGCTTCGCAGCATCTCCGCGCCGGACCCGCAAGTGGAGGTCGAGAACAGAGCGCTCCG 120


3227R-1.IR_full       121 CGATAAGGTCCGCTACTTGGAGGCCAAACTGCAGCAGCACAAGGATCTGCTATCCCAGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     121 CGATAAGGTCCGCTACTTGGAGGCCAAACTGCAGCAGCACAAGGATCTGCTATCCCAGAT 180


3227R-1.IR_full       181 TCATGCCACCTCCGCCAGGATGCAACAGGCATCCTCCCTGCTGGCAGAAAGTAGACCACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     181 TCATGCCACCTCCGCCAGGATGCAACAGGCATCCTCCCTGCTGGCAGAAAGTAGACCACC 240


3227R-1.IR_full       241 CACGCCGCCCGCGGTCCNAGAGCCACCACATTCTCACGCCACCGAGTTCAGAGATATGTG 300
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     241 CACGCCGCCCGCGGTCC-AGAGCCACCACATTCTCACGCCACCGAGTTCAGAGATATGTG 300


3227R-1.IR_full       301 CGCCCGCGCAGNAATCCCCAGATTCTGGACTACAAGATCATCTCGGCACCCGACGATGCG 360
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     301 CGCCCGCGCAG-AATCCCCAGATTCTGGACTACAAGATCATCTCGGCACCCGACGATGCG 360


3227R-1.IR_full       361 GATGCCATTGAGATTCGCCTGGCGGCGGAGAGTCTGAACAGCCTGAGCACCTCTGCGGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     361 GATGCCATTGAGATTCGCCTGGCGGCGGAGAGTCTGAACAGCCTGAGCACCTCTGCGGAC 420


3227R-1.IR_full       421 TCAGATCGCCTGGAGATTTGCCTGGGCGACGAGAATCATCAGCAGAGCAATCATCACAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3227R-1.in silico     421 TCAGATCGCCTGGAGATTTGCCTGGGCGACGAGAATCATCAGCAGAGCAATCATCACAAT 480


3227R-1.IR_full       481 TCCCAGCAGCAGTACAGGATTNAG 504
                          ||||||||||||||||||||| ||
3227R-1.in silico     481 TCCCAGCAGCAGTACAGGATT-AG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134846.2  CG3227-RA (insv), mRNA 
0.62   NM_079230.2  CG32386-RA (corn), mRNA 
0.2   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_132991.1  CG12432-RA (CG12432), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0   NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0   NM_132100.3  CG10695-RA (Pat1), mRNA 
0   NM_135777.1  CG16813-RA (CG16813), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_135891.3  CG4140-RA (CG4140), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   13  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0   NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0   NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0   NM_140872.1  CG9330-RA (CG9330), mRNA 
0   NM_078769.2  CG11181-RA (cup), mRNA 
0   NM_163890.1  CG32491-RE, transcript variant E (mod(mdg4)), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_140510.2  CG7275-RA (CG7275), mRNA 
0   NM_163886.1  CG32491-RP, transcript variant P (mod(mdg4)), mRNA 
0   NM_163885.1  CG32491-RJ, transcript variant J (mod(mdg4)), mRNA 
0   NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.