National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3226R-3 
 Symbol CG3226  Full Name CG3226 
 CG No CG3226  Old CG No CG3226 
 Synonyms Q9W3Y3, CG3226 
 Accession No (Link to NCBI) NM_132104.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAAAGGTGCCCGCGTAAAA 
 Primer Seq. 3'
aatctagaggtaccTTAACAAGCGCCGATTCGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAAAGGTG CCCGCGTAAA AGACGTGCTG ACCACCGCTA AAGCGGAGGC GGAACGGGAG 
0061 ATTGTCAATC TGGAGTTGAA GGCCAAAATT GCGGCAGAGC GACAGGCCAC CGGGTCGAGC 
0121 GAAGCCAAGA GATATCTGCA CGAGCTGACC GACTACGGCT GGGACCAGAG CGCCAAGTTC 
0181 GTGAAGCTCT TCATCACCTT GAACGGAGTG CAGGGCNTGC ACGGAGGAGA ATGTGACAGT 
0241 CACCTACACA CCTAACTCGT TGCAGCTCCA TGTGCGCGAT CTTCAGGGCA AGGACTTTGG 
0301 GCTGACCGTA AACAATCTGC TGCACAGTAT CGATGTGGAG AAGAGCTACC GAAAGATCAA 
0361 GACCGACATG GTGGCCATCT ATCTGCAGAA GGTTGAGGAC AAGCACTGGG ATGTGCTCAC 
0421 CGCTATCCAG AAGCGTTTGA AGCAGAAGAA GGACAGCGAA TTGTCCAAAG ATGGCGACAA 
0481 TCCCGAATCG GCGCTTGTTA A 
 in silico PCR Fragment
0001 GCGAAAGGTG CCCGCGTAAA AGACGTGCTG ACCACCGCTA AAGCGGAGGC GGAACGGGAG 
0061 ATTGTCAATC TGGAGTTGAA GGCCAAAATT GCGGCAGAGC GACAGGCCAC CGGGTCGAGC 
0121 GAAGCCAAGA GATATCTGCA CGAGCTGACC GACTACGGCT GGGACCAGAG CGCCAAGTTC 
0181 GTGAAGCTCT TCATCACCTT GAACGGAGTG CAGGGC-TGC ACGGAGGAGA ATGTGACAGT 
0241 CACCTACACA CCTAACTCGT TGCAGCTCCA TGTGCGCGAT CTTCAGGGCA AGGACTTTGG 
0301 GCTGACCGTA AACAATCTGC TGCACAGTAT CGATGTGGAG AAGAGCTACC GAAAGATCAA 
0361 GACCGACATG GTGGCCATCT ATCTGCAGAA GGTTGAGGAC AAGCACTGGG ATGTGCTCAC 
0421 CGCTATCCAG AAGCGTTTGA AGCAAAAGAA GGACAGCGAA TTGTCCAAAG ATGGCGACAA 
0481 TCCCGAATCG GCGCTTGTTA A 
 Assemble Data

3226R-3.IR_full       1   GCGAAAGGTGCCCGCGTAAAAGACGTGCTGACCACCGCTAAAGCGGAGGCGGAACGGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     1   GCGAAAGGTGCCCGCGTAAAAGACGTGCTGACCACCGCTAAAGCGGAGGCGGAACGGGAG 60


3226R-3.IR_full       61  ATTGTCAATCTGGAGTTGAAGGCCAAAATTGCGGCAGAGCGACAGGCCACCGGGTCGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     61  ATTGTCAATCTGGAGTTGAAGGCCAAAATTGCGGCAGAGCGACAGGCCACCGGGTCGAGC 120


3226R-3.IR_full       121 GAAGCCAAGAGATATCTGCACGAGCTGACCGACTACGGCTGGGACCAGAGCGCCAAGTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     121 GAAGCCAAGAGATATCTGCACGAGCTGACCGACTACGGCTGGGACCAGAGCGCCAAGTTC 180


3226R-3.IR_full       181 GTGAAGCTCTTCATCACCTTGAACGGAGTGCAGGGCNTGCACGGAGGAGAATGTGACAGT 240
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
3226R-3.in silico     181 GTGAAGCTCTTCATCACCTTGAACGGAGTGCAGGGC-TGCACGGAGGAGAATGTGACAGT 240


3226R-3.IR_full       241 CACCTACACACCTAACTCGTTGCAGCTCCATGTGCGCGATCTTCAGGGCAAGGACTTTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     241 CACCTACACACCTAACTCGTTGCAGCTCCATGTGCGCGATCTTCAGGGCAAGGACTTTGG 300


3226R-3.IR_full       301 GCTGACCGTAAACAATCTGCTGCACAGTATCGATGTGGAGAAGAGCTACCGAAAGATCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     301 GCTGACCGTAAACAATCTGCTGCACAGTATCGATGTGGAGAAGAGCTACCGAAAGATCAA 360


3226R-3.IR_full       361 GACCGACATGGTGGCCATCTATCTGCAGAAGGTTGAGGACAAGCACTGGGATGTGCTCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3226R-3.in silico     361 GACCGACATGGTGGCCATCTATCTGCAGAAGGTTGAGGACAAGCACTGGGATGTGCTCAC 420


3226R-3.IR_full       421 CGCTATCCAGAAGCGTTTGAAGCAGAAGAAGGACAGCGAATTGTCCAAAGATGGCGACAA 480
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
3226R-3.in silico     421 CGCTATCCAGAAGCGTTTGAAGCAAAAGAAGGACAGCGAATTGTCCAAAGATGGCGACAA 480


3226R-3.IR_full       481 TCCCGAATCGGCGCTTGTTAA 501
                          |||||||||||||||||||||
3226R-3.in silico     481 TCCCGAATCGGCGCTTGTTAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132104.2  CG3226-RA (CG3226), mRNA 
0   NM_135235.2  CG10805-RA (CG10805), mRNA 
0   NM_136600.1  CG13743-RA (CG13743), mRNA 
0   NM_168450.1  CG6210-RB, transcript variant B (srt), mRNA 
0   NM_140188.2  CG6210-RA, transcript variant A (srt), mRNA 
0   NM_135736.2  CG6153-RA (CG6153), mRNA 
0   NM_132185.1  CG15325-RA (CG15325), mRNA 
0   NM_001015167.1  CG40196-PA.3 (CG40196), mRNA 
0   NM_001015168.1  CG40196-PB.3 (CG40196), mRNA 
0   NM_057797.2  CG10387-RA (tos), mRNA 
0   NM_165465.1  CG1765-RB, transcript variant B (EcR), mRNA 
0   NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
0   NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
0   NM_137881.1  CG3649-RA (CG3649), mRNA 
0   NM_135775.2  CG16812-RA (CG16812), mRNA 
0   NM_140684.1  CG14060-RA (CG14060), mRNA 
0   NM_057986.3  CG3456-RA (Mct1), mRNA 
0   NM_134683.1  CG4297-RA, transcript variant A (CG4297), mRNA 
0   NM_175945.1  CG4297-RB, transcript variant B (CG4297), mRNA 
0   NM_144019.1  CG18672-RA (CG18672), mRNA 
0   10  NM_167846.1  CG1086-RA, transcript variant A (Glut1), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_136682.1  CG1671-RA (CG1671), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_138177.2  CG7008-RA (Tudor-SN), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_140763.1  CG7408-RB (CG7408), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   10  NM_001014545.1  CG33519-RB (Unc-89), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.