National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32253R-2 
 Symbol CG11583  Full Name CG11583 
 CG No CG11583  Old CG No CG32253 
 Synonyms CG32253, CG11583 
 Accession No (Link to NCBI) NM_001038900.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGATAGTGCCGCTGGATGA 
 Primer Seq. 3'
aatctagaggtaccCGGAGTAGGTCTGCACGAACA 
 Predicted Fragment Size
491 
 IR fragment full Seq
0001 GNAGATAGTG CCGCTGGATG AAAATCCACC ACTGCCGCCA CAGAGATCGT CAGATGATGT 
0061 GGTGCCCAAA AAGGAAAAAT GGGTGAACAA ACAGCGCGTG CTGGTCTTNC TCCGCCCGCG 
0121 GTATTAGCCA CCGGGACCGG CACTTAATGA AGGATATTAA GACCCTAATG CCGCACCACC 
0181 GACCCGAATC CAAAATGGAG CGCTCCAAAA CCTTGTCGGT GGTCAACGAA ATGTGCGAAA 
0241 TGAAGCACTG CAACAANGGC GATGCTGTTC GAGGGACGCC GGAAAAGGGA TCTGTACATG 
0301 TGGATATCCA ACACCTCGGG ATCGACTGGT CCATCCGCTA AATTCCTCAT CGAAAACATT 
0361 CATACAATGG CCGAACTGAA GATGACGGGA AACTGCTTGC GGGGATCACG TCCGCTGCTC 
0421 TCGTTTGACT CCAAATTCGA CGAGCTGCCG CACCTTAAGC TGCTCAAGGA GCTGTTCGTG 
0481 CAGACCTACT CCG 
 in silico PCR Fragment
0001 GGAGATAGTG CCGCTGGATG AAAATCCACC ACTGCCGCCA CAGAGATCGT CAGATGATGT 
0061 GGTGCCCAAA AAGGAAAAAT GGGTGAACAA ACAGCGCGTG CTGGTCTT-C TCCGCCCGCG 
0121 GTATTAGCCA CCGGGACCGG CACTTAATGA AGGATATTAA GACCCTAATG CCGCACCACC 
0181 GACCCGAATC CAAAATGGAG CGCTCCAAAA CCTTGTCGGT GGTCAACGAA ATGTGCGAAA 
0241 TGAAGCACTG CAACAA-GGC GATGCTGTTC GAGGGACGCC GGAAAAGGGA TCTGTACATG 
0301 TGGATATCCA ACACCTCGGG ATCGACTGGT CCATCCGCTA AATTCCTCAT CGAAAACATT 
0361 CATACAATGG CCGAACTGAA GATGACGGGA AACTGCTTGC GGGGATCACG TCCGCTGCTC 
0421 TCGTTTGACT CCAAATTCGA CGAGCTGCCG CACCTTAAGC TGCTCAAGGA GCTGTTCGTG 
0481 CAGACCTACT CCG 
 Assemble Data

32253R-2.IR_full       1   GNAGATAGTGCCGCTGGATGAAAATCCACCACTGCCGCCACAGAGATCGTCAGATGATGT 60
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     1   GGAGATAGTGCCGCTGGATGAAAATCCACCACTGCCGCCACAGAGATCGTCAGATGATGT 60


32253R-2.IR_full       61  GGTGCCCAAAAAGGAAAAATGGGTGAACAAACAGCGCGTGCTGGTCTTNCTCCGCCCGCG 120
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
32253R-2.in silico     61  GGTGCCCAAAAAGGAAAAATGGGTGAACAAACAGCGCGTGCTGGTCTT-CTCCGCCCGCG 120


32253R-2.IR_full       121 GTATTAGCCACCGGGACCGGCACTTAATGAAGGATATTAAGACCCTAATGCCGCACCACC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     121 GTATTAGCCACCGGGACCGGCACTTAATGAAGGATATTAAGACCCTAATGCCGCACCACC 180


32253R-2.IR_full       181 GACCCGAATCCAAAATGGAGCGCTCCAAAACCTTGTCGGTGGTCAACGAAATGTGCGAAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     181 GACCCGAATCCAAAATGGAGCGCTCCAAAACCTTGTCGGTGGTCAACGAAATGTGCGAAA 240


32253R-2.IR_full       241 TGAAGCACTGCAACAANGGCGATGCTGTTCGAGGGACGCCGGAAAAGGGATCTGTACATG 300
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     241 TGAAGCACTGCAACAA-GGCGATGCTGTTCGAGGGACGCCGGAAAAGGGATCTGTACATG 300


32253R-2.IR_full       301 TGGATATCCAACACCTCGGGATCGACTGGTCCATCCGCTAAATTCCTCATCGAAAACATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     301 TGGATATCCAACACCTCGGGATCGACTGGTCCATCCGCTAAATTCCTCATCGAAAACATT 360


32253R-2.IR_full       361 CATACAATGGCCGAACTGAAGATGACGGGAAACTGCTTGCGGGGATCACGTCCGCTGCTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     361 CATACAATGGCCGAACTGAAGATGACGGGAAACTGCTTGCGGGGATCACGTCCGCTGCTC 420


32253R-2.IR_full       421 TCGTTTGACTCCAAATTCGACGAGCTGCCGCACCTTAAGCTGCTCAAGGAGCTGTTCGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32253R-2.in silico     421 TCGTTTGACTCCAAATTCGACGAGCTGCCGCACCTTAAGCTGCTCAAGGAGCTGTTCGTG 480


32253R-2.IR_full       481 CAGACCTACTCCG 493
                           |||||||||||||
32253R-2.in silico     481 CAGACCTACTCCG 493

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   473  NM_001038900.1  CG11583-RA (CG11583), mRNA 
0.21   NM_143108.1  CG11859-RA (CG11859), mRNA 
0   NM_135110.1  CG11147-RA, transcript variant A (CG11147), mRNA 
0   NM_164658.1  CG11147-RB, transcript variant B (CG11147), mRNA 
0   NM_170546.1  CG31005-RA (CG31005), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_134924.1  CG3327-RB, transcript variant B (E23), mRNA 
0   NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
0   NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
0   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 
0   NM_136699.3  CG12128-RA, transcript variant A (CG12128), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   16  NM_079729.2  CG4792-RA (Dcr-1), mRNA 
0   NM_165718.1  CG30008-RA (CG30008), mRNA 
0   NM_140928.2  CG32223-RA (CG32223), mRNA 
0   NM_143689.1  CG11093-RA (CG11093), mRNA 
0   13  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_164454.1  CG31671-RA (tho2), mRNA 
0   NM_140508.1  CG13455-RA (CG13455), mRNA 
0   NM_135664.2  CG14930-RA (CG14930), mRNA 
0   NM_168644.1  CG12284-RB, transcript variant B (th), mRNA 
0   NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_142672.2  CG5630-RA (CG5630), mRNA 
0   NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
0   NM_079377.2  CG12284-RA, transcript variant A (th), mRNA 
0   NM_168645.1  CG12284-RC, transcript variant C (th), mRNA 
0   NM_165039.1  CG31852-RA (Tap42), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.