National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32243R-3 
 Symbol CG32243  Full Name CG32243 
 CG No CG32243  Old CG No CG32243 
 Synonyms BcDNA:RE12890, CG32243 
 Accession No (Link to NCBI) NM_168094.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGGTCTAATGGTCACCCCGT 
 Primer Seq. 3'
aatctagaggtaccCCAGCTTCGGTATTGAGGGCA 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 CAGGTCTAAT GGTCACCCCG TATCTTGGAG TTTACAAGCA AACCGATGGT CGCGTTGAGC 
0061 TAAAAACGTA TACTACTCAC TCAGATATGG CACCCAAATA AGAAAGATAT ACCAATAACA 
0121 CCCGAATCGT TGAAAAAAAG CATCCAGTGT GACTAATAAA CTTAGAAAAA TCATCATACA 
0181 TTCAGTTCCA TTTCTGGTTT ATCCTGAAGA GGTTTTCGAC TTCTGCGCCA GTGAAAAGGA 
0241 TGCTTTCGTC GATTTTGAAT CCTCATAGTT CTACACAATC TGGTGATGTG GCTGGTCTAT 
0301 CCGATTCCTT AGTATTATTT ACGAATAATC TGTACAATTC ACGCCTTGAA TCGCTGATGA 
0361 ATAATAATAA TAATGATCCC AGCATTTTTG TTAATCAGCA ACGATCGGCG TGGGATAAGA 
0421 TTGCTAGGGA ATCATTTAAA ATTGAGGGAA ATGTGAATCT CATTCGTTGT TGCAATGGAG 
0481 TGCCCTCAAT ACCGAAGCTG G 
 in silico PCR Fragment
0001 CAGGTCTAAT GGTCACCCCG TATCTTGGAG TTTACAAGCA AACCGATGGT CGCGTTGAGC 
0061 TAAAAACGTA TACTAC-CAC TCAGATATGG CACCCAAATA AGAAAGATAT ACCAATAACA 
0121 CCCGAATCGT TG-AAAAAAG CATCCAGTGT GACTAATAAA CTTAGAAAAA TCATCATACA 
0181 TTCAGTTCCA TTTCTGGTTT ATCCTGAAGA GGTTTTCGAC TTCTGCGCCA GTGAAAA-GA 
0241 TGCTTTCGTC GATTTTGAAT CCTCATAGTT CTACACAATC TGGTGATGTG GCTGGTCTAT 
0301 CCGATTCCTT AGTATTATTT ACGAATAATC TGTACAATTC ACGCCTTGAA TCGCTGATGA 
0361 ATAATAATAA TAATGATCCC AGCATTTTTG TTAATCAGCA ACGATCGGCG TGGGATAAGA 
0421 TTGCTAGGGA ATCATTTAAA ATTGAGGGAA ATGTGAATCT CATTCGTTGT TGCAATGGAG 
0481 TGCCCTCAAT ACCGAAGCTG G 
 Assemble Data

32243R-3.IR_full       1   CAGGTCTAATGGTCACCCCGTATCTTGGAGTTTACAAGCAAACCGATGGTCGCGTTGAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     1   CAGGTCTAATGGTCACCCCGTATCTTGGAGTTTACAAGCAAACCGATGGTCGCGTTGAGC 60


32243R-3.IR_full       61  TAAAAACGTATACTACTCACTCAGATATGGCACCCAAATAAGAAAGATATACCAATAACA 120
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     61  TAAAAACGTATACTAC-CACTCAGATATGGCACCCAAATAAGAAAGATATACCAATAACA 120


32243R-3.IR_full       121 CCCGAATCGTTGAAAAAAAGCATCCAGTGTGACTAATAAACTTAGAAAAATCATCATACA 180
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     121 CCCGAATCGTTG-AAAAAAGCATCCAGTGTGACTAATAAACTTAGAAAAATCATCATACA 180


32243R-3.IR_full       181 TTCAGTTCCATTTCTGGTTTATCCTGAAGAGGTTTTCGACTTCTGCGCCAGTGAAAAGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
32243R-3.in silico     181 TTCAGTTCCATTTCTGGTTTATCCTGAAGAGGTTTTCGACTTCTGCGCCAGTGAAAA-GA 240


32243R-3.IR_full       241 TGCTTTCGTCGATTTTGAATCCTCATAGTTCTACACAATCTGGTGATGTGGCTGGTCTAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     241 TGCTTTCGTCGATTTTGAATCCTCATAGTTCTACACAATCTGGTGATGTGGCTGGTCTAT 300


32243R-3.IR_full       301 CCGATTCCTTAGTATTATTTACGAATAATCTGTACAATTCACGCCTTGAATCGCTGATGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     301 CCGATTCCTTAGTATTATTTACGAATAATCTGTACAATTCACGCCTTGAATCGCTGATGA 360


32243R-3.IR_full       361 ATAATAATAATAATGATCCCAGCATTTTTGTTAATCAGCAACGATCGGCGTGGGATAAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     361 ATAATAATAATAATGATCCCAGCATTTTTGTTAATCAGCAACGATCGGCGTGGGATAAGA 420


32243R-3.IR_full       421 TTGCTAGGGAATCATTTAAAATTGAGGGAAATGTGAATCTCATTCGTTGTTGCAATGGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32243R-3.in silico     421 TTGCTAGGGAATCATTTAAAATTGAGGGAAATGTGAATCTCATTCGTTGTTGCAATGGAG 480


32243R-3.IR_full       481 TGCCCTCAATACCGAAGCTGG 501
                           |||||||||||||||||||||
32243R-3.in silico     481 TGCCCTCAATACCGAAGCTGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_168094.1  CG32243-RA (CG32243), mRNA 
0   NM_165216.1  CG6794-RB, transcript variant B (Dif), mRNA 
0   NM_078865.2  CG6794-RA, transcript variant A (Dif), mRNA 
0   NM_135993.2  CG15141-RA (CG15141), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_138160.2  CG7047-RB, transcript variant B (CG7047), mRNA 
0   NM_167798.1  CG7047-RC, transcript variant C (CG7047), mRNA 
0   NM_206221.1  CG7047-RA, transcript variant A (CG7047), mRNA 
0   15  NM_168859.1  CG5130-RB, transcript variant B (CG5130), mRNA 
0   NM_079259.2  CG4974-RA (dally), mRNA 
0   32  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   16  NM_143038.1  CG13636-RA, transcript variant A (CG13636), mRNA 
0   16  NM_170172.1  CG13636-RB, transcript variant B (CG13636), mRNA 
0   15  NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   15  NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   14  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   14  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   26  NM_141121.2  CG7139-RA, transcript variant A (CG7139), mRNA 
0   16  NM_079521.2  CG1147-RA (NPFR1), mRNA 
0   15  NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0   13  NM_132170.1  CG11369-RA (CG11369), mRNA 
0   NM_078515.2  CG1435-RA, transcript variant A (CBP), mRNA 
0   NM_206638.1  CG1435-RB, transcript variant B (CBP), mRNA 
0   NM_142325.2  CG3534-RA (CG3534), mRNA 
0   NM_166986.2  CG2849-RA, transcript variant A (Rala), mRNA 
0   NM_080324.3  CG2849-RC, transcript variant C (Rala), mRNA 
0   NM_166985.2  CG2849-RB, transcript variant B (Rala), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.