National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32195R-2 
 Symbol CG32195  Full Name CG32195 
 CG No CG32195  Old CG No CG32195 
 Synonyms CG32195 
 Accession No (Link to NCBI) NM_168762.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGAGCGGGAAATTTACAGTG 
 Primer Seq. 3'
aatctagaggtaccCTCGTACAAAACCTTGGATGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGAGCGGGA AATTTACAGT GCGGAATACT TCGAGAGAGC TTTGGCGAGA GCTTATGGTT 
0061 GTGAAATGCT TCGCGTTGAG AACTTTCACA TCAAGGCGGT GAGCCAGNAA GGGCGAGAAC 
0121 TTTTGCAGCG TCATCTACCG GGTGGCGTTG GACTTTCGCA GGTCCACCCG ATGGCGCTCT 
0181 CGAATCAGGA AAATATATTC TCAAGGATNC TNCTGCCCGC CGCTGCTGCA TTGGGCACCA 
0241 ACGAAAAGGA TATGTTCGAG GTACTCCTGC CTGCCATGCA AGCCATTCTT GAAGAAGCTC 
0301 CAAAGGAGAT TGGCGAACAC AAgCTGAGCG CAGATTGCTT GCTAGTCGAG ATATCTGCTG 
0361 GAAAAGAGCT CTACATTCTG GAGGATCTGG GCGCCCTAGG ATACGAATCC TTTGATCGTC 
0421 GTCAAGGCTT AAATCTGGAA GAAGCCAAAA TTTGCGTAAG GAAACTGGCT CAGTTCCACG 
0481 GTGCATCCAA GGTTTTGTAC GAG 
 in silico PCR Fragment
0001 TGGAGCGGGA AATTTACAGT GCGGAATACT TCGAGAGAGC TTTGGCGAGA GCTTATGGTT 
0061 GTGAAATGCT TCGCGTTGAG AACTTTCACA TCAAGGCGGT GAGCCAG-AA GGGCGAGAAC 
0121 TTTTGCAGCG TCATCTACCG GGTGGCGTTG GTCTTTCGCA GGT-CACCCG ATGGCGCTCT 
0181 CGAATCAGGA AAATATATTC TCAAGGAT-C TGCTGCCCGC CGCCGCTGCA CTGGGCACCA 
0241 ACGAAAAGGA TATGTTCGAG GTACTCCTGC CTGCCATGCA AGCCATTCTT GAAGAAGCTC 
0301 CAAAGGAGAT TGGCGAACAC AAGCTGAGCG CAGATTGCTT GCTAGTCGAG ATATCTGCTG 
0361 GAAAAGAGCT CTACATTCTG GAGGATCTGG GCGCCCTAGG ATACGAATCC TTTGATCGTC 
0421 GTCAAGGCTT AAATCTGGAA GAAGCCAAAA TTTGCGTAAG GAAACTGGCT CAGTTCCACG 
0481 GTGCATCCAA GGTTTTGTAC GAG 
 Assemble Data

32195R-2.IR_full       1   TGGAGCGGGAAATTTACAGTGCGGAATACTTCGAGAGAGCTTTGGCGAGAGCTTATGGTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32195R-2.in silico     1   TGGAGCGGGAAATTTACAGTGCGGAATACTTCGAGAGAGCTTTGGCGAGAGCTTATGGTT 60


32195R-2.IR_full       61  GTGAAATGCTTCGCGTTGAGAACTTTCACATCAAGGCGGTGAGCCAGNAAGGGCGAGAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
32195R-2.in silico     61  GTGAAATGCTTCGCGTTGAGAACTTTCACATCAAGGCGGTGAGCCAG-AAGGGCGAGAAC 120


32195R-2.IR_full       121 TTTTGCAGCGTCATCTACCGGGTGGCGTTGGACTTTCGCAGGTCCACCCGATGGCGCTCT 180
                           ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
32195R-2.in silico     121 TTTTGCAGCGTCATCTACCGGGTGGCGTTGGTCTTTCGCAGGT-CACCCGATGGCGCTCT 180


32195R-2.IR_full       181 CGAATCAGGAAAATATATTCTCAAGGATNCTNCTGCCCGCCGCTGCTGCATTGGGCACCA 240
                           |||||||||||||||||||||||||||| || ||||||||||| |||||| |||||||||
32195R-2.in silico     181 CGAATCAGGAAAATATATTCTCAAGGAT-CTGCTGCCCGCCGCCGCTGCACTGGGCACCA 240


32195R-2.IR_full       241 ACGAAAAGGATATGTTCGAGGTACTCCTGCCTGCCATGCAAGCCATTCTTGAAGAAGCTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32195R-2.in silico     241 ACGAAAAGGATATGTTCGAGGTACTCCTGCCTGCCATGCAAGCCATTCTTGAAGAAGCTC 300


32195R-2.IR_full       301 CAAAGGAGATTGGCGAACACAAGCTGAGCGCAGATTGCTTGCTAGTCGAGATATCTGCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32195R-2.in silico     301 CAAAGGAGATTGGCGAACACAAGCTGAGCGCAGATTGCTTGCTAGTCGAGATATCTGCTG 360


32195R-2.IR_full       361 GAAAAGAGCTCTACATTCTGGAGGATCTGGGCGCCCTAGGATACGAATCCTTTGATCGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32195R-2.in silico     361 GAAAAGAGCTCTACATTCTGGAGGATCTGGGCGCCCTAGGATACGAATCCTTTGATCGTC 420


32195R-2.IR_full       421 GTCAAGGCTTAAATCTGGAAGAAGCCAAAATTTGCGTAAGGAAACTGGCTCAGTTCCACG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32195R-2.in silico     421 GTCAAGGCTTAAATCTGGAAGAAGCCAAAATTTGCGTAAGGAAACTGGCTCAGTTCCACG 480


32195R-2.IR_full       481 GTGCATCCAAGGTTTTGTACGAG 503
                           |||||||||||||||||||||||
32195R-2.in silico     481 GTGCATCCAAGGTTTTGTACGAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168762.2  CG32195-RA (CG32195), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   13  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_169869.1  CG31219-RA (CG31219), mRNA 
0   NM_142975.2  CG5669-RA (CG5669), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   NM_141420.2  CG2342-RA (Ccp84Ag), mRNA 
0   NM_176045.1  CG4220-RB, transcript variant B (elB), mRNA 
0   NM_167374.1  CG32632-RB (Tango13), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_132435.1  CG1582-RA (CG1582), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_205990.1  CG4220-RC, transcript variant C (elB), mRNA 
0   NM_078842.4  CG4220-RA, transcript variant A (elB), mRNA 
0   NM_142586.1  CG4538-RA, transcript variant A (CG4538), mRNA 
0   NM_169880.1  CG4538-RB, transcript variant B (CG4538), mRNA 
0   NM_134543.2  CG11738-RA (l(1)G0004), mRNA 
0   NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.