National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32190R-3 
 Symbol NUCB1  Full Name NUCB1 
 CG No CG32190  Old CG No CG32190 
 Synonyms CG5587, nucb1, CG32190, NUCB1 
 Accession No (Link to NCBI) NM_140751.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGTTTGAGCGTGAGGCGCA 
 Primer Seq. 3'
aatctagaggtaccCGTACTCCAGATACTCCTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAGTTTGAG CGTGAgGCGC AGAAAAAGGA AATGGATGAG GAGTCGCGGA AGAAGTTTGA 
0061 GACCGAGCTC AAGGAGAAGG AGGAAAAGCA TAAGGACCAC GAGAAGCTGC ACCACCCTGG 
0121 CAACAAGGCC CAACTAGAGG ATGTGTGGGA GAAGCAGGAC CACATGGACA AGAACGACTT 
0181 TGATCCGAAG ACATTCTTCT CCATCCACGA CGTCGACAGC AACGGCNTAC TGGGACGAGG 
0241 CTGAGGTCAA AGCTCTGTTT GTCAAGGAAC TGGACAAGGT CTATCAGAGT GATCTTCCCG 
0301 AGGACGATAT GAGGGAGCGA GCAGAGGAAA TGGAACGTAT GCGCGAGCAC TACTTTCAGG 
0361 AGACGGACAT GAACCACGAC GGCTTAATCA GCATCGACGA GTTCATGGTG CAGACTAACA 
0421 AGGAAGAATT TCAAAAGGAC CCCGAATGGG AGACCATCGA CCGACAGCAG CAGTATACAC 
0481 ACGAGGAGTA TCTGGAGTAC G 
 in silico PCR Fragment
0001 AGAGTTTGAG CGTGAGGCGC AGAAAAAGGA AATGGATGAG GAGTCGCGGA AGAAGTTTGA 
0061 GACCGAGCTC AAGGAGAAGG AGGAAAAGCA TAAGGACCAC GAGAAGCTGC ACCACCCTGG 
0121 CAACAAGGCC CAACTAGAGG ATGTGTGGGA GAAGCAGGAC CACATGGACA AGAACGACTT 
0181 TGATCCGAAG ACATTCTTCT CCATCCACGA CGTCGACAGC AACGGC-TAC TGGGACGAGG 
0241 CTGAGGTCAA AGCTCTGTTT GTCAAGGAAC TGGACAAGGT CTATCAGAGT GATCTTCCCG 
0301 AGGACGATAT GAGGGAGCGA GCAGAGGAAA TGGAACGTAT GCGCGAGCAC TACTTTCAGG 
0361 AGACGGACAT GAACCACGAC GGCTTAATCA GCATCGACGA GTTCATGGTG CAGACTAACA 
0421 AGGAAGAATT TCAAAAGGAC CCCGAATGGG AGACCATCGA CCGACAGCAG CAGTATACAC 
0481 ACGAGGAGTA TCTGGAGTAC G 
 Assemble Data

32190R-3.IR_full       1   AGAGTTTGAGCGTGAGGCGCAGAAAAAGGAAATGGATGAGGAGTCGCGGAAGAAGTTTGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     1   AGAGTTTGAGCGTGAGGCGCAGAAAAAGGAAATGGATGAGGAGTCGCGGAAGAAGTTTGA 60


32190R-3.IR_full       61  GACCGAGCTCAAGGAGAAGGAGGAAAAGCATAAGGACCACGAGAAGCTGCACCACCCTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     61  GACCGAGCTCAAGGAGAAGGAGGAAAAGCATAAGGACCACGAGAAGCTGCACCACCCTGG 120


32190R-3.IR_full       121 CAACAAGGCCCAACTAGAGGATGTGTGGGAGAAGCAGGACCACATGGACAAGAACGACTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     121 CAACAAGGCCCAACTAGAGGATGTGTGGGAGAAGCAGGACCACATGGACAAGAACGACTT 180


32190R-3.IR_full       181 TGATCCGAAGACATTCTTCTCCATCCACGACGTCGACAGCAACGGCNTACTGGGACGAGG 240
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
32190R-3.in silico     181 TGATCCGAAGACATTCTTCTCCATCCACGACGTCGACAGCAACGGC-TACTGGGACGAGG 240


32190R-3.IR_full       241 CTGAGGTCAAAGCTCTGTTTGTCAAGGAACTGGACAAGGTCTATCAGAGTGATCTTCCCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     241 CTGAGGTCAAAGCTCTGTTTGTCAAGGAACTGGACAAGGTCTATCAGAGTGATCTTCCCG 300


32190R-3.IR_full       301 AGGACGATATGAGGGAGCGAGCAGAGGAAATGGAACGTATGCGCGAGCACTACTTTCAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     301 AGGACGATATGAGGGAGCGAGCAGAGGAAATGGAACGTATGCGCGAGCACTACTTTCAGG 360


32190R-3.IR_full       361 AGACGGACATGAACCACGACGGCTTAATCAGCATCGACGAGTTCATGGTGCAGACTAACA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     361 AGACGGACATGAACCACGACGGCTTAATCAGCATCGACGAGTTCATGGTGCAGACTAACA 420


32190R-3.IR_full       421 AGGAAGAATTTCAAAAGGACCCCGAATGGGAGACCATCGACCGACAGCAGCAGTATACAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32190R-3.in silico     421 AGGAAGAATTTCAAAAGGACCCCGAATGGGAGACCATCGACCGACAGCAGCAGTATACAC 480


32190R-3.IR_full       481 ACGAGGAGTATCTGGAGTACG 501
                           |||||||||||||||||||||
32190R-3.in silico     481 ACGAGGAGTATCTGGAGTACG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140751.2  CG32190-RA (NUCB1), mRNA 
0.2   NM_001043095.1  CG15078-RB, transcript variant B (Mctp), mRNA 
0.2   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0.2   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   12  53  NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_138079.1  CG13582-RA (CG13582), mRNA 
0   NM_168712.2  CG6652-RB, transcript variant B (CG6652), mRNA 
0   NM_140689.3  CG6652-RA, transcript variant A (CG6652), mRNA 
0   NM_164748.1  CG5171-RB, transcript variant B (CG5171), mRNA 
0   NM_135269.1  CG5171-RA, transcript variant A (CG5171), mRNA 
0   NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
0   NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
0   NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
0   NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
0   NM_170152.1  CG13624-RD, transcript variant D (CG13624), mRNA 
0   NM_170151.1  CG13624-RB, transcript variant B (CG13624), mRNA 
0   NM_001043287.1  CG13624-RE, transcript variant E (CG13624), mRNA 
0   NM_170150.1  CG13624-RA, transcript variant A (CG13624), mRNA 
0   NM_001043288.1  CG13624-RF, transcript variant F (CG13624), mRNA 
0   NM_143014.2  CG13624-RC, transcript variant C (CG13624), mRNA 
0   NM_168839.1  CG32228-RA (CG32228), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_133130.2  CG14193-RA (CG14193), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.