National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32182R-2 
 Symbol CG32182  Full Name CG32182 
 CG No CG32182  Old CG No CG32182 
 Synonyms CG32182 
 Accession No (Link to NCBI) NM_168746.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTAATGGAGCTGGACGACGACTGTCTGCTAATGATTTGCGAACATCTAGCGCTGGGAGAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAACTGAGACTGATGGAGGTGCAGGAGGAACGATTTTCGAGCTTGATACTGCAATTGTGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCAACAGATACGCCAAGCTATTTGATTTTCGCCGGGAGCAGCAATTAAACCTGCTAAAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCGACGAGCTGGCTCAAATATTGGATCACTTAGGCTGGCGAACAAGAGCGTTAATTAAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCCAGGTACAGGCGAAGGATGCCGGAAGTGGCTCAAGCGGATGCGACAAAGCCTCAAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATTTGCAGATACTCAGTTTCACGAAAAGCAATACATTGGTAATACAGAAACTCCCCTAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGTGCCCCAATGTGGTGGACCTTAAGCTTGGCGAGTGCGAGGGTTTAACACCCCTTGAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTGGATTTCATGTTTGAAAACCTTAAAAACCTAAGAGAATTTGAAATGCGCTCTAGTTGG 480

32182R-2.IR_full       481 ANCTGCAGCCAACAGAGGTA 500
                           | |||||||||||||||||| silico     481 AACTGCAGCCAACAGAGGTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168746.1  CG32182-RA (CG32182), mRNA 
0   NM_137179.2  CG8079-RA, transcript variant A (CG8079), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_080505.2  CG8361-RA (HLHm7), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_133164.2  CG10142-RA (Ance-5), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_176356.1  CG9614-RF, transcript variant F (pip), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   NM_168480.1  CG7283-RB, transcript variant B (RpL10Ab), mRNA 
0   NM_168481.1  CG7283-RC, transcript variant C (RpL10Ab), mRNA 
0   NM_140257.1  CG7283-RA, transcript variant A (RpL10Ab), mRNA 
0   NM_001031939.1  CG33718-RA, transcript variant A (Pmi), mRNA 
0   NM_001031941.1  CG33717-RB, transcript variant B (PGRP-LD), mRNA 
0   NM_001031942.1  CG33717-RA, transcript variant A (PGRP-LD), mRNA 
0   NM_145192.2  CG15107-RA (CG15107), mRNA 
0   NM_135250.2  CG9100-RB, transcript variant B (Rab30), mRNA 
0   NM_164728.1  CG9100-RA, transcript variant A (Rab30), mRNA 
0   NM_164729.1  CG9100-RC, transcript variant C (Rab30), mRNA 
0   NM_141109.1  CG7148-RA (CG7148), mRNA 
0   NM_141133.1  CG11449-RA (CG11449), mRNA 
0   NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
0   10  NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   10  NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   10  NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   10  NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   10  NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   10  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   10  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.