National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32182R-1 
 Symbol CG32182  Full Name CG32182 
 CG No CG32182  Old CG No CG32182 
 Synonyms CG32182 
 Accession No (Link to NCBI) NM_168746.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAATGGAGCTGGACGACGAC 
 Primer Seq. 3'
aatctagaggtaccTACCTCTGTTGGCTGCAGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTAATGGAGC TGGACGACGA CTGTCTGCTA ATGATTTGCG AACATCTAGC GCTGGGAGAC 
0061 CAACTGAGAC TGATGGAGGT GCAGGAGGAA CGATTTTCGA GCTTGATACT GCAATTGTGG 
0121 TCCAACAGAT ACGCCAAGCT ATTTGATTTT CGCCGGGAGC AGCAATTAAA CCTGCTAAAG 
0181 CCCGACGAGC TGGCTCAAAT ATTGGATCAC TTAGGCTGGC GAACAAGAGC GTTAATTAAC 
0241 CTGCCAGGTA CAGGCGAAGG ATGCCGGAAG TGGCTCAAGC GGATGCGACA AAGCCTCAAC 
0301 CATTTGCAGA TACTCAGTTT CACGAAAAGC AATACATTGG TAATACAGAA ACTCCCCTAC 
0361 CTGTGCCCCA ATGTGGTGGA CCTTAAGCTT GGCGAGTGCG AGGGTTTAAC ACCCCTTGAT 
0421 GTGGATTTCA TGTTTGAAAA CCTTAAAAAC CTAAGAGAAT TTGAAATGCG CTCTAGTTGG 
0481 ANCTGCAGCC AACAGAGGTA  
 in silico PCR Fragment
0001 CTAATGGAGC TGGACGACGA CTGTCTGCTA ATGATTTGCG AACATCTAGC GCTGGGAGAC 
0061 CAACTGAGAC TGATGGAGGT GCAGGAGGAA CGATTTTCGA GCTTGATACT GCAATTGTGG 
0121 TCCAACAGAT ACGCCAAGCT ATTTGATTTT CGCCGGGAGC AGCAATTAAA CCTGCTAAAG 
0181 CCCGACGAGC TGGCTCAAAT ATTGGATCAC TTAGGCTGGC GAACAAGAGC GTTAATTAAC 
0241 CTGCCAGGTA CAGGCGAAGG ATGCCGGAAG TGGCTCAAGC GGATGCGACA AAGCCTCAAC 
0301 CATTTGCAGA TACTCAGTTT CACGAAAAGC AATACATTGG TAATACAGAA ACTCCCCTAC 
0361 CTGTGCCCCA ATGTGGTGGA CCTTAAGCTT GGCGAGTGCG AGGGTTTAAC ACCCCTTGAT 
0421 GTGGATTTCA TGTTTGAAAA CCTTAAAAAC CTAAGAGAAT TTGAAATGCG CTCTAGTTGG 
0481 AACTGCAGCC AACAGAGGTA  
 Assemble Data

32182R-1.IR_full       1   CTAATGGAGCTGGACGACGACTGTCTGCTAATGATTTGCGAACATCTAGCGCTGGGAGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     1   CTAATGGAGCTGGACGACGACTGTCTGCTAATGATTTGCGAACATCTAGCGCTGGGAGAC 60


32182R-1.IR_full       61  CAACTGAGACTGATGGAGGTGCAGGAGGAACGATTTTCGAGCTTGATACTGCAATTGTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     61  CAACTGAGACTGATGGAGGTGCAGGAGGAACGATTTTCGAGCTTGATACTGCAATTGTGG 120


32182R-1.IR_full       121 TCCAACAGATACGCCAAGCTATTTGATTTTCGCCGGGAGCAGCAATTAAACCTGCTAAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     121 TCCAACAGATACGCCAAGCTATTTGATTTTCGCCGGGAGCAGCAATTAAACCTGCTAAAG 180


32182R-1.IR_full       181 CCCGACGAGCTGGCTCAAATATTGGATCACTTAGGCTGGCGAACAAGAGCGTTAATTAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     181 CCCGACGAGCTGGCTCAAATATTGGATCACTTAGGCTGGCGAACAAGAGCGTTAATTAAC 240


32182R-1.IR_full       241 CTGCCAGGTACAGGCGAAGGATGCCGGAAGTGGCTCAAGCGGATGCGACAAAGCCTCAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     241 CTGCCAGGTACAGGCGAAGGATGCCGGAAGTGGCTCAAGCGGATGCGACAAAGCCTCAAC 300


32182R-1.IR_full       301 CATTTGCAGATACTCAGTTTCACGAAAAGCAATACATTGGTAATACAGAAACTCCCCTAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     301 CATTTGCAGATACTCAGTTTCACGAAAAGCAATACATTGGTAATACAGAAACTCCCCTAC 360


32182R-1.IR_full       361 CTGTGCCCCAATGTGGTGGACCTTAAGCTTGGCGAGTGCGAGGGTTTAACACCCCTTGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     361 CTGTGCCCCAATGTGGTGGACCTTAAGCTTGGCGAGTGCGAGGGTTTAACACCCCTTGAT 420


32182R-1.IR_full       421 GTGGATTTCATGTTTGAAAACCTTAAAAACCTAAGAGAATTTGAAATGCGCTCTAGTTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32182R-1.in silico     421 GTGGATTTCATGTTTGAAAACCTTAAAAACCTAAGAGAATTTGAAATGCGCTCTAGTTGG 480


32182R-1.IR_full       481 ANCTGCAGCCAACAGAGGTA 500
                           | ||||||||||||||||||
32182R-1.in silico     481 AACTGCAGCCAACAGAGGTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168746.1  CG32182-RA (CG32182), mRNA 
0   NM_137179.2  CG8079-RA, transcript variant A (CG8079), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_080505.2  CG8361-RA (HLHm7), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_133164.2  CG10142-RA (Ance-5), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_176356.1  CG9614-RF, transcript variant F (pip), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   NM_168480.1  CG7283-RB, transcript variant B (RpL10Ab), mRNA 
0   NM_168481.1  CG7283-RC, transcript variant C (RpL10Ab), mRNA 
0   NM_140257.1  CG7283-RA, transcript variant A (RpL10Ab), mRNA 
0   NM_001031939.1  CG33718-RA, transcript variant A (Pmi), mRNA 
0   NM_001031941.1  CG33717-RB, transcript variant B (PGRP-LD), mRNA 
0   NM_001031942.1  CG33717-RA, transcript variant A (PGRP-LD), mRNA 
0   NM_145192.2  CG15107-RA (CG15107), mRNA 
0   NM_135250.2  CG9100-RB, transcript variant B (Rab30), mRNA 
0   NM_164728.1  CG9100-RA, transcript variant A (Rab30), mRNA 
0   NM_164729.1  CG9100-RC, transcript variant C (Rab30), mRNA 
0   NM_141109.1  CG7148-RA (CG7148), mRNA 
0   NM_141133.1  CG11449-RA (CG11449), mRNA 
0   NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
0   10  NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   10  NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   10  NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   10  NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   10  NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   10  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   10  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.