National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32178R-3 
 Symbol Msi  Full Name Male-specific insect derived growth factor 
 CG No CG32178  Old CG No CG32178 
 Synonyms ADGF-A2, MSI, BcDNA:AT05468, CG32178, Msi 
 Accession No (Link to NCBI) NM_080281.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACTCGACGAGGAGGAGAATC 
 Primer Seq. 3'
aatctagaggtaccGTCCTGTTCCAAGTTAACGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACTCGACGA GGAGGAGAAT CGCCGGCAAA TGTCGTCCAG TAAATATGGT GGCGTCTGCT 
0061 TCCACGTGGC CATAGCCGTC ATGCTTTGTG TAATGGTGTT GGTGCTAATT TGTTCGGCTC 
0121 CCCTTGGAGA AAACATGTCC AATCTTACGT CCGAGGAGCG GCACGCTCgC CTGAGGCAGA 
0181 TTTACATTGA GAAAGAGCGC CGGCAAAGAC TTGGCAGCAG GATGGGCTTG AGTCCGCTGG 
0241 AGGAGGAGGC CAATGATCGG CTCATGGCCA TTAGGCAGGT GGATGAGGAG TTTTATAATC 
0301 TCTGGAGGAA CTACCACTCC CAGCCACCGC CGTTTCTCAA ACATCTGAAC ATCATCGATA 
0361 CGAATCTTTA TGCGGCACTT AAGAGCNATG CCCAAGGGCG GACTCCTTCA CGTCCACGAT 
0421 TCGGGAATGT TGAGAATGGA AATTCTCATC GATTTGATCT ACCGCGATAA CCTGTGGGTC 
0481 TGCGTTAACT TGGAACAGGA C 
 in silico PCR Fragment
0001 AACTCGACGA GGAGGAGAAT CGCCGGCAAA TGTCGTCCAG TAAATATGGT GGCGTCTGCT 
0061 TCCACGTGGC CATAGCCGTC ATGCTTTGTG TAATGGTGTT GGTGCTAATT TGTTCGGCTC 
0121 CCCTTGGAGA AAACATGTCC AATCTTACGT CCGAGGAGCG GCACGCTCGC CTGAGGCAGA 
0181 TTTACATTGA GAAAGAGCGC CGGCAAAGAC TTGGCAGCAG GATGGGCTTG AGTCCGCTGG 
0241 AGGAGGAGGC CAATGATCGG CTCATGGCCA TTAGGCAGGT GGATGAGGAG TTTTATAATC 
0301 TCTGGAGGAA CTACCACTCC CAGCCACCGC CGTTTCTCAA ACATCTGAAC ATCATCGATA 
0361 CGAATCTTTA TGCGGCACTT AAGAGC-ATG CCCAAGGGCG GACTCCTTCA CGTCCACGAT 
0421 TCGGGAATGT TGAGAATGGA AATTCTCATC GATTTGATCT ACCGCGATAA CCTGTGGGTC 
0481 TGCGTTAACT TGGAACAGGA C 
 Assemble Data

32178R-3.IR_full       1   AACTCGACGAGGAGGAGAATCGCCGGCAAATGTCGTCCAGTAAATATGGTGGCGTCTGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     1   AACTCGACGAGGAGGAGAATCGCCGGCAAATGTCGTCCAGTAAATATGGTGGCGTCTGCT 60


32178R-3.IR_full       61  TCCACGTGGCCATAGCCGTCATGCTTTGTGTAATGGTGTTGGTGCTAATTTGTTCGGCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     61  TCCACGTGGCCATAGCCGTCATGCTTTGTGTAATGGTGTTGGTGCTAATTTGTTCGGCTC 120


32178R-3.IR_full       121 CCCTTGGAGAAAACATGTCCAATCTTACGTCCGAGGAGCGGCACGCTCGCCTGAGGCAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     121 CCCTTGGAGAAAACATGTCCAATCTTACGTCCGAGGAGCGGCACGCTCGCCTGAGGCAGA 180


32178R-3.IR_full       181 TTTACATTGAGAAAGAGCGCCGGCAAAGACTTGGCAGCAGGATGGGCTTGAGTCCGCTGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     181 TTTACATTGAGAAAGAGCGCCGGCAAAGACTTGGCAGCAGGATGGGCTTGAGTCCGCTGG 240


32178R-3.IR_full       241 AGGAGGAGGCCAATGATCGGCTCATGGCCATTAGGCAGGTGGATGAGGAGTTTTATAATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     241 AGGAGGAGGCCAATGATCGGCTCATGGCCATTAGGCAGGTGGATGAGGAGTTTTATAATC 300


32178R-3.IR_full       301 TCTGGAGGAACTACCACTCCCAGCCACCGCCGTTTCTCAAACATCTGAACATCATCGATA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     301 TCTGGAGGAACTACCACTCCCAGCCACCGCCGTTTCTCAAACATCTGAACATCATCGATA 360


32178R-3.IR_full       361 CGAATCTTTATGCGGCACTTAAGAGCNATGCCCAAGGGCGGACTCCTTCACGTCCACGAT 420
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
32178R-3.in silico     361 CGAATCTTTATGCGGCACTTAAGAGC-ATGCCCAAGGGCGGACTCCTTCACGTCCACGAT 420


32178R-3.IR_full       421 TCGGGAATGTTGAGAATGGAAATTCTCATCGATTTGATCTACCGCGATAACCTGTGGGTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32178R-3.in silico     421 TCGGGAATGTTGAGAATGGAAATTCTCATCGATTTGATCTACCGCGATAACCTGTGGGTC 480


32178R-3.IR_full       481 TGCGTTAACTTGGAACAGGAC 501
                           |||||||||||||||||||||
32178R-3.in silico     481 TGCGTTAACTTGGAACAGGAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080281.3  CG32178-RA, transcript variant A (Msi), mRNA 
100   482  NM_001043147.1  CG32178-RB, transcript variant B (Msi), mRNA 
100   482  NM_001043148.1  CG32178-RC, transcript variant C (Msi), mRNA 
0   NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_079305.2  CG7293-RA (Klp68D), mRNA 
0   NM_170029.1  CG31161-RA (CG31161), mRNA 
0   NM_136912.2  CG13164-RA, transcript variant A (SIP2), mRNA 
0   NM_165873.2  CG13164-RC, transcript variant C (SIP2), mRNA 
0   NM_165874.1  CG13164-RE, transcript variant E (SIP2), mRNA 
0   NM_176152.1  CG13164-RG, transcript variant G (SIP2), mRNA 
0   NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   NM_143219.1  CG5432-RA (CG5432), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_136667.2  CG1794-RA, transcript variant A (Mmp2), mRNA 
0   NM_206066.1  CG1794-RB, transcript variant B (Mmp2), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_206050.1  CG11140-RE, transcript variant E (Aldh-III), mRNA 
0   NM_136441.2  CG11140-RH, transcript variant H (Aldh-III), mRNA 
0   NM_165531.1  CG11140-RF, transcript variant F (Aldh-III), mRNA 
0   NM_165532.1  CG11140-RG, transcript variant G (Aldh-III), mRNA 
0   NM_165529.1  CG11140-RC, transcript variant C (Aldh-III), mRNA 
0   NM_165528.1  CG11140-RB, transcript variant B (Aldh-III), mRNA 
0   NM_165526.1  CG11140-RI, transcript variant I (Aldh-III), mRNA 
0   NM_165527.1  CG11140-RA, transcript variant A (Aldh-III), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.