National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32155R-1 
 Symbol CG32155  Full Name CG32155 
 CG No CG32155  Old CG No CG32155 
 Synonyms CG5082, CG32155 
 Accession No (Link to NCBI) NM_168655.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTTGCTGATCTTCATCGGA 
 Primer Seq. 3'
aatctagaggtaccGCAAACAGGCGGCTCTTCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTTGCTGA TCTTCATCGG AGCTCTGTTG GCCGCTTCAG AGGCTGGCAT CTCATCGCCC 
0061 ATCATAGGGG TTCTTACACA GGAAGTTTAC GTCGATGGTT TGATCTCGAG ACATTTTGAT 
0121 AACAAGACCA GCTATATAGC CGCCTCGTAT GTGAAGTATC TCGAAGGAGC TGGAGCCCGA 
0181 GTGGTGCCGA TTTGGATCGG TCGCAATCGC AGCTACTACG ACGATCTCAT GCGCAAGATA 
0241 AATGGAGTCT TGTTGCCCGG TGGAGCCACT TGGTTTAATC AGAGTAATGG TTATGCGGAT 
0301 GCGGGCGAAC ACCTCATCCA CTTGGCCATT GAACTAAATG ATCAGGGCGT CTTTATGCCG 
0361 GTGTGGGGCA CTTGTCTGGG CATGGAACTA TTGGTTTACA AGCTGGCCAA CGAAACGGAA 
0421 CACCGCATTA ATTGCGAAGC GNCNNGCATG GCCGTGCCTA TGGAGTTTAA AGAAGACTAT 
0481 AAGAAGAGcC GCCTGTTTCG C 
 in silico PCR Fragment
0001 AGCTTGCTGA TCTTCATCGG AGCTCTGTTG GCCGCTTCAG AGGCTGGCAT CTCATCGCCC 
0061 ATCATAGGGG TTCTCACACA GGAAGTTTAC GTCGATGGTT TGATCTCGAG ACATTTTGAT 
0121 AACAAGACCA GCTATATAGC CGCCTCGTAT GTGAAGTATC TCGAAGGAGC TGGAGCCCGA 
0181 GTAGTGCCGA TTTGGATCGG TCGCAATCGC AGCTACTACG ACGATCTCAT GCGCAAGATA 
0241 AATGGAGTCT TGTTGCCCGG TGGAGCCACT TGGTTTAATC AGAGTAATGG GTATGCGGAT 
0301 GCGGGCGAAC ACCTCATCCA CTTGGCCATT GAACTAAATG ATCAGGGCGT CTTTATGCCG 
0361 GTGTGGGGCA CTTGTCTGGG CATGGAACTA TTGGTTTACA AGCTGGCCAA CGAAACGGAA 
0421 CACCGCATTA ATTGCGAAGC GACCGGCATG GCCGTGCCTA TGGAGTTTAA AGAAGACTAT 
0481 AAGAAGAGCC GCCTGTTT-G C 
 Assemble Data

32155R-1.IR_full       1   AGCTTGCTGATCTTCATCGGAGCTCTGTTGGCCGCTTCAGAGGCTGGCATCTCATCGCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     1   AGCTTGCTGATCTTCATCGGAGCTCTGTTGGCCGCTTCAGAGGCTGGCATCTCATCGCCC 60


32155R-1.IR_full       61  ATCATAGGGGTTCTTACACAGGAAGTTTACGTCGATGGTTTGATCTCGAGACATTTTGAT 120
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     61  ATCATAGGGGTTCTCACACAGGAAGTTTACGTCGATGGTTTGATCTCGAGACATTTTGAT 120


32155R-1.IR_full       121 AACAAGACCAGCTATATAGCCGCCTCGTATGTGAAGTATCTCGAAGGAGCTGGAGCCCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     121 AACAAGACCAGCTATATAGCCGCCTCGTATGTGAAGTATCTCGAAGGAGCTGGAGCCCGA 180


32155R-1.IR_full       181 GTGGTGCCGATTTGGATCGGTCGCAATCGCAGCTACTACGACGATCTCATGCGCAAGATA 240
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     181 GTAGTGCCGATTTGGATCGGTCGCAATCGCAGCTACTACGACGATCTCATGCGCAAGATA 240


32155R-1.IR_full       241 AATGGAGTCTTGTTGCCCGGTGGAGCCACTTGGTTTAATCAGAGTAATGGTTATGCGGAT 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
32155R-1.in silico     241 AATGGAGTCTTGTTGCCCGGTGGAGCCACTTGGTTTAATCAGAGTAATGGGTATGCGGAT 300


32155R-1.IR_full       301 GCGGGCGAACACCTCATCCACTTGGCCATTGAACTAAATGATCAGGGCGTCTTTATGCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     301 GCGGGCGAACACCTCATCCACTTGGCCATTGAACTAAATGATCAGGGCGTCTTTATGCCG 360


32155R-1.IR_full       361 GTGTGGGGCACTTGTCTGGGCATGGAACTATTGGTTTACAAGCTGGCCAACGAAACGGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32155R-1.in silico     361 GTGTGGGGCACTTGTCTGGGCATGGAACTATTGGTTTACAAGCTGGCCAACGAAACGGAA 420


32155R-1.IR_full       421 CACCGCATTAATTGCGAAGCGNCNNGCATGGCCGTGCCTATGGAGTTTAAAGAAGACTAT 480
                           ||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||
32155R-1.in silico     421 CACCGCATTAATTGCGAAGCGACCGGCATGGCCGTGCCTATGGAGTTTAAAGAAGACTAT 480


32155R-1.IR_full       481 AAGAAGAGCCGCCTGTTTCGC 501
                           |||||||||||||||||| ||
32155R-1.in silico     481 AAGAAGAGCCGCCTGTTT-GC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0   NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0   NM_132081.2  CG15896-RA (CG15896), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_170256.1  CG8384-RC, transcript variant C (gro), mRNA 
0   NM_170254.1  CG8384-RA, transcript variant A (gro), mRNA 
0   NM_079790.3  CG8384-RD, transcript variant D (gro), mRNA 
0   NM_206575.1  CG8384-RE, transcript variant E (gro), mRNA 
0   NM_170255.2  CG8384-RB, transcript variant B (gro), mRNA 
0   NM_206624.1  CG5014-RC, transcript variant C (Vap-33-1), mRNA 
0   NM_206623.1  CG5014-RD, transcript variant D (Vap-33-1), mRNA 
0   NM_206625.1  CG5014-RA, transcript variant A (Vap-33-1), mRNA 
0   NM_130731.2  CG5014-RB, transcript variant B (Vap-33-1), mRNA 
0   NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0   NM_167024.1  CG6899-RB, transcript variant B (Ptp4E), mRNA 
0   NM_140962.1  CG13248-RA (CG13248), mRNA 
0   NM_136966.1  CG8771-RA (CG8771), mRNA 
0   NM_166120.1  CG30085-RA (CG30085), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_136640.2  CG8801-RA (CG8801), mRNA 
0   NM_079998.2  CG5912-RA (arr), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_058124.2  CG5772-RA (Sur), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.