National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3214R-1 
 Symbol CG3214  Full Name CG3214 
 CG No CG3214  Old CG No CG3214 
 Synonyms anon-EST:Posey62, BcDNA:GH12382, CG3214 
 Accession No (Link to NCBI) NM_134848.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Honjo K, Mauthner SE, Wang Y, Skene JHP, Tracey WD Jr.
Nociceptor-Enriched Genes Required for Normal Thermal Nociception.
Cell Rep (2016) 16(2) 295-303 [ PubMed ID = 27346357 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTTTTGGGCATCAACCGGCT 
 Primer Seq. 3'
aatctagaggtaccCTGCTTCTTCGCCTTGGGTTC 
 Predicted Fragment Size
418 
 IR fragment full Seq
0001 GTTTTTGGGC ATCAACCGGC TGACAAAGCT GTTCCAGATG GTCCGCGAAG CCGGAGGACT 
0061 GAAGCAAGCG TACCTGAAGC TCTATAGGAA CGATGATCTG AAGATCGGAA CCCTGGTGGG 
0121 CATCGACAAG TACGGCAACA AGTACTTCGA GAACCCGTAC TACTTCTACG GCCGCAATCG 
0181 CTGGATCGAG TTCGCCCCCC ACGTCAACAT GGACTACGAT GGATCCATGA TTCCCGCCGA 
0241 GTGGTACGGC TGGATGCACT ACAAGACCGA TCTGCCTCCC ATTCGCGATG GATGCCGCCC 
0301 CAAGTACAAG TGGATAGCGG ACCACAGCGA GAATCTTTCC GGCACTAAGG AGGCCTACTA 
0361 CCCCTACTCC ACAACACCCA ACAAAGTGGA GGCCTGGGAA CCCAAGGCGA AGAAGCAG 
 in silico PCR Fragment
0001 GTTTTTGGGC ATCAACCGGC TGACAAAGCT GTTCCAGATG GTCCGCGAAG CCGGAGGACT 
0061 GAAGCAAGCG TACCTGAAGC TCTATAGGAA CGATGATCTG AAGATCGGAA CCCTGGTGGG 
0121 CATCGACAAG TACGGCAACA AGTACTTCGA GAACCCGTAC TACTTCTACG GCCGCAATCG 
0181 CTGGATCGAG TTCGCCCCCC ACGTCAACAT GGACTACGAT GGATCCATGA TTCCCGCCGA 
0241 GTGGTACGGC TGGATGCACT ACAAGACCGA TCTGCCTCCC ATTCGCGATG GATGCCGCCC 
0301 CAAGTACAAG TGGATAGCGG ACCACAGCGA GAATCTTTCC GGAACTAAGG AGGCCTACTA 
0361 CCCCTACTCC ACAACACCCA ACAAAGTGGA GGCCTGGGAA CCCAAGGCGA AGAAGCAG 
 Assemble Data

3214R-1.IR_full       1   GTTTTTGGGCATCAACCGGCTGACAAAGCTGTTCCAGATGGTCCGCGAAGCCGGAGGACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     1   GTTTTTGGGCATCAACCGGCTGACAAAGCTGTTCCAGATGGTCCGCGAAGCCGGAGGACT 60


3214R-1.IR_full       61  GAAGCAAGCGTACCTGAAGCTCTATAGGAACGATGATCTGAAGATCGGAACCCTGGTGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     61  GAAGCAAGCGTACCTGAAGCTCTATAGGAACGATGATCTGAAGATCGGAACCCTGGTGGG 120


3214R-1.IR_full       121 CATCGACAAGTACGGCAACAAGTACTTCGAGAACCCGTACTACTTCTACGGCCGCAATCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     121 CATCGACAAGTACGGCAACAAGTACTTCGAGAACCCGTACTACTTCTACGGCCGCAATCG 180


3214R-1.IR_full       181 CTGGATCGAGTTCGCCCCCCACGTCAACATGGACTACGATGGATCCATGATTCCCGCCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     181 CTGGATCGAGTTCGCCCCCCACGTCAACATGGACTACGATGGATCCATGATTCCCGCCGA 240


3214R-1.IR_full       241 GTGGTACGGCTGGATGCACTACAAGACCGATCTGCCTCCCATTCGCGATGGATGCCGCCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     241 GTGGTACGGCTGGATGCACTACAAGACCGATCTGCCTCCCATTCGCGATGGATGCCGCCC 300


3214R-1.IR_full       301 CAAGTACAAGTGGATAGCGGACCACAGCGAGAATCTTTCCGGCACTAAGGAGGCCTACTA 360
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
3214R-1.in silico     301 CAAGTACAAGTGGATAGCGGACCACAGCGAGAATCTTTCCGGAACTAAGGAGGCCTACTA 360


3214R-1.IR_full       361 CCCCTACTCCACAACACCCAACAAAGTGGAGGCCTGGGAACCCAAGGCGAAGAAGCAG 418
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3214R-1.in silico     361 CCCCTACTCCACAACACCCAACAAAGTGGAGGCCTGGGAACCCAAGGCGAAGAAGCAG 418

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   400  NM_134848.1  CG3214-RA (CG3214), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_140113.1  CG6709-RA (CG6709), mRNA 
0   NM_139447.1  CG2034-RA (CG2034), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   NM_057676.3  CG11312-RA (insc), mRNA 
0   NM_136888.2  CG12367-RA (CG12367), mRNA 
0   NM_132196.2  CG10777-RB (CG10777), mRNA 
0   NM_079794.2  CG5490-RB, transcript variant B (Tl), mRNA 
0   NM_170287.1  CG5490-RA, transcript variant A (Tl), mRNA 
0   NM_164752.2  CG12789-RA, transcript variant A (CG12789), mRNA 
0   NM_135277.2  CG12789-RB, transcript variant B (CG12789), mRNA 
0   NM_080712.5  CG1693-RA, transcript variant A (tty), mRNA 
0   NM_167744.3  CG1693-RB, transcript variant B (tty), mRNA 
0   NM_141208.3  CG14647-RA (CG14647), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_079858.3  CG12070-RA, transcript variant A (Sap-r), mRNA 
0   NM_170529.2  CG12070-RB, transcript variant B (Sap-r), mRNA 
0   NM_136206.1  CG2617-RA (CG2617), mRNA 
0   NM_167395.1  CG32597-RA (l(1)G0469), mRNA 
0   NM_169033.2  CG12163-RA, transcript variant A (CG12163), mRNA 
0   NM_141264.2  CG12163-RB, transcript variant B (CG12163), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_140725.1  CG18265-RA (CG18265), mRNA 
0   NM_206226.1  CG12038-RB, transcript variant B (CG12038), mRNA 
0   NM_206227.1  CG12038-RA, transcript variant A (CG12038), mRNA 
0   NM_139405.1  CG12020-RA (CG12020), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.