National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32137R-3 
 Symbol CG32137  Full Name CG32137 
 CG No CG32137  Old CG No CG32137 
 Synonyms CG17366, CG17365, CG32137 
 Accession No (Link to NCBI) NM_168564.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGACATCCTATTGGCCGCCGA 
 Primer Seq. 3'
aatctagaggtaccCTTCCTGGGCGATTTGCAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNACATCCTA TTGGCCGCCG AACTGGGCAA gGCACTGCTC GAGAAGAACG AGGAGCTGGT 
0061 CAAACAGCAG GAAAAGCTCA TCGAGGACTA TTCGAGCAAA ATTGAGAAAC TCGAGCAGGA 
0121 GAAGCNATGT GCTGCGCCAA AAATTGGCGA TCGCCGAGGA TGAGAGCGAT CAGCGTGTCC 
0181 TCGAGCTGCA GTCCGATCTC ACCGAGCTGA AGGATAAGCT GCAGACCCAA GAACACCGCC 
0241 ATCCGGCAAG CGGAGAAGGA GAAGACCATC CTAATTGATG AGCTGCAGCA CCAGAACACA 
0301 CGGCTCACCG AACAGATCCA GGAGGCACAC GCCACCGAGC TCAAGCTCAG CGCACAGATC 
0361 CAGGAGCTGA AGGATCAGTA TCACTACAGG AACAGCAGCC TCCAGCAGGA ACATGTCAAC 
0421 AGCCTGGAGT CCATCAAAAC AGAACTTAAC CTCACTACGG GAAAGCGTCA GGAGCTGGAG 
0481 CGTCGTCTGC AAATCGCCCA GGAAG 
 in silico PCR Fragment
0001 GGACATCCTA TTGGCCGCCG AACTGGGCAA GGCACTGCTC GAGAAGAACG AGGAGCTGGT 
0061 CAAACAGCAG GAAAAGCTCA TCGAGGACTA TTCGAGCAAA ATTGAGAAAC TCGAGCAGGA 
0121 GAAGC-ATGT GCTGCGCCAA AAATTGGCGA TCGCCGAGGA TGAGAGCGAT CAGCGTGTCC 
0181 TCGAGCTGCA GTCCGATCTC ACCGAGCTGA AGGATAAGCT GCAGACCCAA G-ACACCGCC 
0241 ATCCGGCAAG CGGAGAAGGA GAAGACCATC CTAATTGATG AGCTGCAGCA CCAGAACACA 
0301 CGGCTCACCG AACAGATCCA GGAGGCACAC GCCACCGAGC TCAAGCTCAG CGCACAGATC 
0361 CAGGAGCTGA AGGATCAGTA TCACTACAGG AACAGCAGCC TC---CAGGA ACATGTCAAC 
0421 AGCCTGGAGT CCATCAAAAC AGAACTTAAC CTCACTACGG GAAAGCGTCA GGAGCTGGAG 
0481 CGTCGTCTGC AAATCGCCCA GGAAG 
 Assemble Data

32137R-3.IR_full       1   GNACATCCTATTGGCCGCCGAACTGGGCAAGGCACTGCTCGAGAAGAACGAGGAGCTGGT 60
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     1   GGACATCCTATTGGCCGCCGAACTGGGCAAGGCACTGCTCGAGAAGAACGAGGAGCTGGT 60


32137R-3.IR_full       61  CAAACAGCAGGAAAAGCTCATCGAGGACTATTCGAGCAAAATTGAGAAACTCGAGCAGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     61  CAAACAGCAGGAAAAGCTCATCGAGGACTATTCGAGCAAAATTGAGAAACTCGAGCAGGA 120


32137R-3.IR_full       121 GAAGCNATGTGCTGCGCCAAAAATTGGCGATCGCCGAGGATGAGAGCGATCAGCGTGTCC 180
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     121 GAAGC-ATGTGCTGCGCCAAAAATTGGCGATCGCCGAGGATGAGAGCGATCAGCGTGTCC 180


32137R-3.IR_full       181 TCGAGCTGCAGTCCGATCTCACCGAGCTGAAGGATAAGCTGCAGACCCAAGAACACCGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
32137R-3.in silico     181 TCGAGCTGCAGTCCGATCTCACCGAGCTGAAGGATAAGCTGCAGACCCAAG-ACACCGCC 240


32137R-3.IR_full       241 ATCCGGCAAGCGGAGAAGGAGAAGACCATCCTAATTGATGAGCTGCAGCACCAGAACACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     241 ATCCGGCAAGCGGAGAAGGAGAAGACCATCCTAATTGATGAGCTGCAGCACCAGAACACA 300


32137R-3.IR_full       301 CGGCTCACCGAACAGATCCAGGAGGCACACGCCACCGAGCTCAAGCTCAGCGCACAGATC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     301 CGGCTCACCGAACAGATCCAGGAGGCACACGCCACCGAGCTCAAGCTCAGCGCACAGATC 360


32137R-3.IR_full       361 CAGGAGCTGAAGGATCAGTATCACTACAGGAACAGCAGCCTCCAGCAGGAACATGTCAAC 420
                           ||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||
32137R-3.in silico     361 CAGGAGCTGAAGGATCAGTATCACTACAGGAACAGCAGCCTC---CAGGAACATGTCAAC 420


32137R-3.IR_full       421 AGCCTGGAGTCCATCAAAACAGAACTTAACCTCACTACGGGAAAGCGTCAGGAGCTGGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32137R-3.in silico     421 AGCCTGGAGTCCATCAAAACAGAACTTAACCTCACTACGGGAAAGCGTCAGGAGCTGGAG 480


32137R-3.IR_full       481 CGTCGTCTGCAAATCGCCCAGGAAG 505
                           |||||||||||||||||||||||||
32137R-3.in silico     481 CGTCGTCTGCAAATCGCCCAGGAAG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168564.1  CG32137-RA, transcript variant A (CG32137), mRNA 
100   482  NM_168563.1  CG32137-RB, transcript variant B (CG32137), mRNA 
0.2   NM_132084.2  CG12219-RA (CG12219), mRNA 
0.2   NM_141794.1  CG6689-RA (CG6689), mRNA 
0   NM_057748.4  CG5279-RA (Rh5), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_134535.2  CG17068-RA (CG17068), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_136597.3  CG8170-RA, transcript variant A (CG8170), mRNA 
0   NM_001043068.1  CG8170-RB, transcript variant B (CG8170), mRNA 
0   NM_001042852.1  CG12500-RB, transcript variant B (stnA), mRNA 
0   NM_001042851.1  CG12500-RA, transcript variant A (stnA), mRNA 
0   NM_001042854.1  CG12473-RB, transcript variant B (stnB), mRNA 
0   NM_001042853.1  CG12473-RA, transcript variant A (stnB), mRNA 
0   NM_166010.1  CG6315-RB, transcript variant B (fl(2)d), mRNA 
0   NM_079008.2  CG6315-RA, transcript variant A (fl(2)d), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_140495.1  CG12316-RA, transcript variant A (CG12316), mRNA 
0   NM_168611.1  CG12316-RB, transcript variant B (CG12316), mRNA 
0   NM_133059.2  CG6106-RA (CG6106), mRNA 
0   NM_166938.1  CG2841-RC, transcript variant C (ptr), mRNA 
0   NM_080022.2  CG2841-RB, transcript variant B (ptr), mRNA 
0   NM_166937.1  CG2841-RA, transcript variant A (ptr), mRNA 
0   NM_132132.1  CG4557-RA (CG4557), mRNA 
0   NM_165629.1  CG30350-RA (CG30350), mRNA 
0   NM_137082.1  CG13353-RA (CG13353), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.