National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32135R-3 
 Symbol CG32135  Full Name CG32135 
 CG No CG32135  Old CG No CG32135 
 Synonyms CG32135 
 Accession No (Link to NCBI) NM_168566.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCACTGAAGTGGGTGATGA 
 Primer Seq. 3'
aatctagaggtaccTATGTCCAACCGCTCTAGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCACTGAA GTGGGTGATG ATGCCCATTA AGGTGGAGAT ATTCAACTTC AAGCGAAGTG 
0061 GACCGGAAGA TAATATGGCA CGTGGACAAT TTCTGTTGGA CAACCTGTTA AGCGCAAATC 
0121 GCCTAAAACG CTTGCAAGAG GAAGTAGCAG TTATTAACAC GTGCCAGAAA ATCGAGGTGC 
0181 GTGTCACACC CGGTCTGCCC AAATCGATGA TGTGTGCCCA GATAACAGAC GAATTTACAA 
0241 CTGCCATTCA GGAGGCCCNT TAGATCACGC TATGAGGTGG ATTCACGCAC CTTAGATCTC 
0301 TCCAGGTTCC ACGCCAGTCC GGAGTTGTCT CTGCACTTTT GTCCGCTGCA TATGGTCAAG 
0361 CTGCTAGAAA CAGTGCTAGT TCTTTCAAAC CATTTATTTC CCCATGTGAC CAGCCTAGTA 
0421 CTGAGCAACA ATTATTTGTG TTCCCTGAAA GCGTTTGCGG GAAATTCCCA AAGTTTTGCC 
0481 AGCCTAGAGC GGTTGGACAT A 
 in silico PCR Fragment
0001 TGGCACTGAA GTGGGTGATG ATGCCCATTA AGGTGGAGAT ATTCAACTTC AAGCGAAGTG 
0061 GACCGGAAGA TAATATGGCA CGTGGACAAT TTCTGTTGGA CAACCTGTTA AGCGCAAATC 
0121 GCCTAAAACG CTTGCAAGAG GAAGTAGCAG TTATTAACAC GTGCCAGAAA ATCGAGGTGC 
0181 GTGTCACACC CGGTCTGCCC AAATCGATGA TGTGTGCCCA GATAACAGAC GAATTTACAA 
0241 CTGCCATTCA GGAGGCCC-T TAGATCACGC TATGAGGTGG ATTCACGCAC CTTAGATCTC 
0301 TCCAGGTTCC ACGCCAGTCC GGAGTTGTCT CTGCACTTTT GTCCGCTGCA TATGGTCAAG 
0361 CTGCTAGAAA CAGTGCTAGT TCTTTCAAAC CATTTATTTC CCCATGTGAC CAGCCTAGTA 
0421 CTGAGCAACA ATTATTTGTG TTCCCTGAAA GCGTTTGCGG GAAATTCCCA AAGTTTTGCC 
0481 AGCCTAGAGC GGTTGGACAT A 
 Assemble Data

32135R-3.IR_full       1   TGGCACTGAAGTGGGTGATGATGCCCATTAAGGTGGAGATATTCAACTTCAAGCGAAGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     1   TGGCACTGAAGTGGGTGATGATGCCCATTAAGGTGGAGATATTCAACTTCAAGCGAAGTG 60


32135R-3.IR_full       61  GACCGGAAGATAATATGGCACGTGGACAATTTCTGTTGGACAACCTGTTAAGCGCAAATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     61  GACCGGAAGATAATATGGCACGTGGACAATTTCTGTTGGACAACCTGTTAAGCGCAAATC 120


32135R-3.IR_full       121 GCCTAAAACGCTTGCAAGAGGAAGTAGCAGTTATTAACACGTGCCAGAAAATCGAGGTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     121 GCCTAAAACGCTTGCAAGAGGAAGTAGCAGTTATTAACACGTGCCAGAAAATCGAGGTGC 180


32135R-3.IR_full       181 GTGTCACACCCGGTCTGCCCAAATCGATGATGTGTGCCCAGATAACAGACGAATTTACAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     181 GTGTCACACCCGGTCTGCCCAAATCGATGATGTGTGCCCAGATAACAGACGAATTTACAA 240


32135R-3.IR_full       241 CTGCCATTCAGGAGGCCCNTTAGATCACGCTATGAGGTGGATTCACGCACCTTAGATCTC 300
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     241 CTGCCATTCAGGAGGCCC-TTAGATCACGCTATGAGGTGGATTCACGCACCTTAGATCTC 300


32135R-3.IR_full       301 TCCAGGTTCCACGCCAGTCCGGAGTTGTCTCTGCACTTTTGTCCGCTGCATATGGTCAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     301 TCCAGGTTCCACGCCAGTCCGGAGTTGTCTCTGCACTTTTGTCCGCTGCATATGGTCAAG 360


32135R-3.IR_full       361 CTGCTAGAAACAGTGCTAGTTCTTTCAAACCATTTATTTCCCCATGTGACCAGCCTAGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     361 CTGCTAGAAACAGTGCTAGTTCTTTCAAACCATTTATTTCCCCATGTGACCAGCCTAGTA 420


32135R-3.IR_full       421 CTGAGCAACAATTATTTGTGTTCCCTGAAAGCGTTTGCGGGAAATTCCCAAAGTTTTGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32135R-3.in silico     421 CTGAGCAACAATTATTTGTGTTCCCTGAAAGCGTTTGCGGGAAATTCCCAAAGTTTTGCC 480


32135R-3.IR_full       481 AGCCTAGAGCGGTTGGACATA 501
                           |||||||||||||||||||||
32135R-3.in silico     481 AGCCTAGAGCGGTTGGACATA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168566.1  CG32135-RA (CG32135), mRNA 
0   NM_137659.2  CG11132-RA (DMAP1), mRNA 
0   NM_139862.2  CG18417-RA (CG18417), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_141262.2  CG12005-RB (Mms19), mRNA 
0   NM_057542.2  CG6205-RA (por), mRNA 
0   NM_143184.1  CG5959-RA (CG5959), mRNA 
0   NM_140669.2  CG9715-RA (CG9715), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_166559.1  CG3622-RA, transcript variant A (CG3622), mRNA 
0   NM_057859.2  CG12346-RA (cag), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_141779.2  CG6621-RA (CG6621), mRNA 
0   NM_136090.2  CG15173-RA (CG15173), mRNA 
0   NM_141923.2  CG10090-RA (Tim17a1), mRNA 
0   NM_165006.1  CG31862-RA (CG31862), mRNA 
0   NM_144126.1  CG17059-RA (CG17059), mRNA 
0   NM_137063.2  CG6357-RA (CG6357), mRNA 
0   NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   NM_136007.2  CG7094-RA (CG7094), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_136358.2  CG14590-RA (CG14590), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   NM_136014.1  CG5681-RA (CG5681), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.