National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32135R-1 
 Symbol CG32135  Full Name CG32135 
 CG No CG32135  Old CG No CG32135 
 Synonyms CG32135 
 Accession No (Link to NCBI) NM_168566.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCACTGAAGTGGGTGATGATGCCCATTAAGGTGGAGATATTCAACTTCAAGCGAAGTG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCGGAAGATAATATGGCACGTGGACAATTTCTGTTGGACAACCTGTTAAGCGCAAATC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCTAAAACGCTTGCAAGAGGAAGTAGCAGTTATTAACACGTGCCAGAAAATCGAGGTGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGTCACACCCGGTCTGCCCAAATCGATGATGTGTGCCCAGATAACAGACGAATTTACAA 240

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCCATTCAGGAGGCCC-TTAGATCACGCTATGAGGTGGATTCACGCACCTTAGATCTC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCAGGTTCCACGCCAGTCCGGAGTTGTCTCTGCACTTTTGTCCGCTGCATATGGTCAAG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGCTAGAAACAGTGCTAGTTCTTTCAAACCATTTATTTCCCCATGTGACCAGCCTAGTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGAGCAACAATTATTTGTGTTCCCTGAAAGCGTTTGCGGGAAATTCCCAAAGTTTTGCC 480

32135R-1.IR_full       481 AGCCTAGAGCGGTTGGACATA 501
                           ||||||||||||||||||||| silico     481 AGCCTAGAGCGGTTGGACATA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168566.1  CG32135-RA (CG32135), mRNA 
0   NM_137659.2  CG11132-RA (DMAP1), mRNA 
0   NM_139862.2  CG18417-RA (CG18417), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_141262.2  CG12005-RB (Mms19), mRNA 
0   NM_057542.2  CG6205-RA (por), mRNA 
0   NM_143184.1  CG5959-RA (CG5959), mRNA 
0   NM_140669.2  CG9715-RA (CG9715), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_166559.1  CG3622-RA, transcript variant A (CG3622), mRNA 
0   NM_057859.2  CG12346-RA (cag), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_141779.2  CG6621-RA (CG6621), mRNA 
0   NM_136090.2  CG15173-RA (CG15173), mRNA 
0   NM_141923.2  CG10090-RA (Tim17a1), mRNA 
0   NM_165006.1  CG31862-RA (CG31862), mRNA 
0   NM_144126.1  CG17059-RA (CG17059), mRNA 
0   NM_137063.2  CG6357-RA (CG6357), mRNA 
0   NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   NM_136007.2  CG7094-RA (CG7094), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_136358.2  CG14590-RA (CG14590), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   NM_136014.1  CG5681-RA (CG5681), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.