National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32134R-2 
 Symbol btl  Full Name breathless 
 CG No CG32134  Old CG No CG32134 
 Synonyms btl, dev, FGFR, D-FGFR, DFR2, CT20816, CG6714, BTL/FGFR2, dtk2, DFGF-R1, DmHD-311, Dfr-2, 0844/01, Btl, FGFR1, Fgf-r, fgf-r, dFGFR, l(3)00208, Tk2, HD-311, Dtk2, CG32134, lambdatop 
 Accession No (Link to NCBI) NM_168577.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hasygar K, Hietakangas V.
p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.
PLoS Genet. (2014) 10(11) e1004764 [ PubMed ID = 25393288 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAGGTGGCCTTTTTCAGTT 
 Primer Seq. 3'
aatctagaggtaccCCATCAGGACATTTCCAAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCAGGTGGC CTTTTTCAGT TGAACTGCAG TCCCATGGAT CCGGATGCAA AGGGTGTTAA 
0061 TATATCCTGG CTGCACAATG ATACTCAAAT CCTTGGTGGA CGTGGGCGCA TTAAGCTTAA 
0121 AAGGTGGTCA TTAACAGTGG GGCAACTGCA GCCGGACGAT GCTGGAAGCT ATCACTGTGA 
0181 GCTGTGCGTC GAACAGGACT GCCAAAGGAG TAATCCGACC CAATTGGAGG TGATAAGCAG 
0241 AAAGCACACG GTGCCCATGC TAAAACCCGG ATATCCCCGC AATACCAGCA TTGCCCTCGG 
0301 GGACAATGTG AGCATTGAAT GCCTACTTGA GGACTCTGCC CTGGAGCCGA AGATCACGTG 
0361 GCTACATAAG GGGAATGCGG ACAACATCGA TGACCTCTTG CAGCGTTTAA GAGAGCAGTC 
0421 CCAGCTACCT GTGGATGTTA CCCGATTGAT TACCCGAATG GATGAACCGC AGGTaCTTCG 
0481 TCTTGGAAAT GTCCTGATGG  
 in silico PCR Fragment
0001 CGCAGGTGGC CTTTTTCAGT TGAACTGCAG TCCCATGGAT CCGGATGCAA AGGGTGTTAA 
0061 TATATCCTGG CTGCACAATG ATACTCAAAT CCTTGGTGGA CGTGGACGCA TTAAGCTTAA 
0121 AAGGTGGTCA TTAACAGTGG GGCAACTGCA GCCGGAGGAT GCTGGAAGCT ATCACTGTGA 
0181 GCTGTGCGTG GAACAGGACT GCCAAAGGAG TAATCCGACC CAATTGGAGG TGATAAGCAG 
0241 AAAGCACACG GTGCCCATGC TAAAGCCCGG ATATCCCCGC AATACCAGCA TTGCCCTCGG 
0301 GGACAATGTG AGCATTGAAT GCCTACTTGA GGACTCTGCC CTGGAGCCGA AGATCACGTG 
0361 GCTACATAAG GGGAATGCGG ACAACATCGA TGACCTCTTG CAGCGTTTAA GAGAGCAGTC 
0421 CCAGCTACCT GTGGATGTTA CCCGATTGAT TACCCGAATG GATGAACCGC AGGTACTTCG 
0481 TCTTGGAAAT GTCCTGATGG  
 Assemble Data

32134R-2.IR_full       1   CGCAGGTGGCCTTTTTCAGTTGAACTGCAGTCCCATGGATCCGGATGCAAAGGGTGTTAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32134R-2.in silico     1   CGCAGGTGGCCTTTTTCAGTTGAACTGCAGTCCCATGGATCCGGATGCAAAGGGTGTTAA 60


32134R-2.IR_full       61  TATATCCTGGCTGCACAATGATACTCAAATCCTTGGTGGACGTGGGCGCATTAAGCTTAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
32134R-2.in silico     61  TATATCCTGGCTGCACAATGATACTCAAATCCTTGGTGGACGTGGACGCATTAAGCTTAA 120


32134R-2.IR_full       121 AAGGTGGTCATTAACAGTGGGGCAACTGCAGCCGGACGATGCTGGAAGCTATCACTGTGA 180
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
32134R-2.in silico     121 AAGGTGGTCATTAACAGTGGGGCAACTGCAGCCGGAGGATGCTGGAAGCTATCACTGTGA 180


32134R-2.IR_full       181 GCTGTGCGTCGAACAGGACTGCCAAAGGAGTAATCCGACCCAATTGGAGGTGATAAGCAG 240
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
32134R-2.in silico     181 GCTGTGCGTGGAACAGGACTGCCAAAGGAGTAATCCGACCCAATTGGAGGTGATAAGCAG 240


32134R-2.IR_full       241 AAAGCACACGGTGCCCATGCTAAAACCCGGATATCCCCGCAATACCAGCATTGCCCTCGG 300
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
32134R-2.in silico     241 AAAGCACACGGTGCCCATGCTAAAGCCCGGATATCCCCGCAATACCAGCATTGCCCTCGG 300


32134R-2.IR_full       301 GGACAATGTGAGCATTGAATGCCTACTTGAGGACTCTGCCCTGGAGCCGAAGATCACGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32134R-2.in silico     301 GGACAATGTGAGCATTGAATGCCTACTTGAGGACTCTGCCCTGGAGCCGAAGATCACGTG 360


32134R-2.IR_full       361 GCTACATAAGGGGAATGCGGACAACATCGATGACCTCTTGCAGCGTTTAAGAGAGCAGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32134R-2.in silico     361 GCTACATAAGGGGAATGCGGACAACATCGATGACCTCTTGCAGCGTTTAAGAGAGCAGTC 420


32134R-2.IR_full       421 CCAGCTACCTGTGGATGTTACCCGATTGATTACCCGAATGGATGAACCGCAGGTACTTCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32134R-2.in silico     421 CCAGCTACCTGTGGATGTTACCCGATTGATTACCCGAATGGATGAACCGCAGGTACTTCG 480


32134R-2.IR_full       481 TCTTGGAAATGTCCTGATGG 500
                           ||||||||||||||||||||
32134R-2.in silico     481 TCTTGGAAATGTCCTGATGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
100   482  NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_144030.1  CG14583-RA (CG14583), mRNA 
0   NM_164578.1  CG15427-RA, transcript variant A (tutl), mRNA 
0   NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
0   NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
0   NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
0   NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
0   NM_140749.2  CG5998-RA (Adgf-B), mRNA 
0   NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_143645.1  CG1976-RA (RhoGAP100F), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_141604.2  CG11984-RB, transcript variant B (CG11984), mRNA 
0   NM_169253.1  CG11984-RC, transcript variant C (CG11984), mRNA 
0   NM_169252.1  CG11984-RA, transcript variant A (CG11984), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_136619.2  CG30342-RA (CG30342), mRNA 
0   NM_138198.2  CG13893-RA (CG13893), mRNA 
0   NM_135336.2  CG7466-RA (CG7466), mRNA 
0   NM_142277.1  CG10309-RA (pad), mRNA 
0   NM_168167.1  CG32398-RA (CG32398), mRNA 
0   NM_137478.1  CG17522-RA (GstE10), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_140292.2  CG11534-RA (CG11534), mRNA 
0   10  NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_140240.1  CG6053-RA (CG6053), mRNA 
0   NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
0   NM_133065.2  CG32548-RC, transcript variant C (CG32548), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.