National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32134R-1 
 Symbol btl  Full Name breathless 
 CG No CG32134  Old CG No CG32134 
 Synonyms btl, dev, FGFR, D-FGFR, DFR2, CT20816, CG6714, BTL/FGFR2, dtk2, DFGF-R1, DmHD-311, Dfr-2, 0844/01, Btl, FGFR1, Fgf-r, fgf-r, dFGFR, l(3)00208, Tk2, HD-311, Dtk2, CG32134, lambdatop 
 Accession No (Link to NCBI) NM_168577.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCAGGTGGCCTTTTTCAGTTGAACTGCAGTCCCATGGATCCGGATGCAAAGGGTGTTAA 60

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     61  TATATCCTGGCTGCACAATGATACTCAAATCCTTGGTGGACGTGGACGCATTAAGCTTAA 120

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     121 AAGGTGGTCATTAACAGTGGGGCAACTGCAGCCGGAGGATGCTGGAAGCTATCACTGTGA 180

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGTGCGTGGAACAGGACTGCCAAAGGAGTAATCCGACCCAATTGGAGGTGATAAGCAG 240

                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     241 AAAGCACACGGTGCCCATGCTAAAGCCCGGATATCCCCGCAATACCAGCATTGCCCTCGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGACAATGTGAGCATTGAATGCCTACTTGAGGACTCTGCCCTGGAGCCGAAGATCACGTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTACATAAGGGGAATGCGGACAACATCGATGACCTCTTGCAGCGTTTAAGAGAGCAGTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCAGCTACCTGTGGATGTTACCCGATTGATTACCCGAATGGATGAACCGCAGGTACTTCG 480

32134R-1.IR_full       481 TCTTGGAAATGTCCTGATGG 500
                           |||||||||||||||||||| silico     481 TCTTGGAAATGTCCTGATGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
100   482  NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_144030.1  CG14583-RA (CG14583), mRNA 
0   NM_164578.1  CG15427-RA, transcript variant A (tutl), mRNA 
0   NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
0   NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
0   NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
0   NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
0   NM_140749.2  CG5998-RA (Adgf-B), mRNA 
0   NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_143645.1  CG1976-RA (RhoGAP100F), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_141604.2  CG11984-RB, transcript variant B (CG11984), mRNA 
0   NM_169253.1  CG11984-RC, transcript variant C (CG11984), mRNA 
0   NM_169252.1  CG11984-RA, transcript variant A (CG11984), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_136619.2  CG30342-RA (CG30342), mRNA 
0   NM_138198.2  CG13893-RA (CG13893), mRNA 
0   NM_135336.2  CG7466-RA (CG7466), mRNA 
0   NM_142277.1  CG10309-RA (pad), mRNA 
0   NM_168167.1  CG32398-RA (CG32398), mRNA 
0   NM_137478.1  CG17522-RA (GstE10), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_140292.2  CG11534-RA (CG11534), mRNA 
0   10  NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_140240.1  CG6053-RA (CG6053), mRNA 
0   NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
0   NM_133065.2  CG32548-RC, transcript variant C (CG32548), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.