National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3210R-4 
 Symbol Drp1  Full Name Dynamin related protein 1 
 CG No CG3210  Old CG No CG3210 
 Synonyms CG3210, Dnm1/Drp1, l(2)22Fc, l(2)ND2, l(2)ND3, unnamed, l(2)22Fd, Drp1, drp1, Drp, DRP1, frat, KG03815 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGCCCTAATTCCGGTCATA 
 Primer Seq. 3'
aatctagaggtaccAATTCTTTGATCTGCGCCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNNGCCCTAA TTCCGGTCAT ANACAAGCTG CAGGACGTCT TCAACACCGT GGGCTCCGAC 
0061 TCCATCCAAT TGCCCCAAAT TGTTGTTCTA GGCAGTCAGA GCTCCGGCAA GAGTTCGGTG 
0121 ATCGAGAGCG TTGTGGGACG ATCCTTTCTG CCCCGTGGAA CTGGTATTGT GACCCGTCGC 
0181 CCACTGGTGC TCCAGCTGAT CTACAGCCCA CTCGATGATC GCGAGAATCG CTCGGCGGAA 
0241 AATGGTACGT CCAATGCCGA GGAGTGGGGC CGCTTCCTGC ACACCAAGAA GTGCTTCACG 
0301 GACTTTGACG AGATCCGCAA GGAGATCGAA AACGAAACGG AGCGGGCGGC GGGCAGCAAC 
0361 AAGGGCATCT GCCCGGAGCC CATCAACCTG AAGATATTCT CGATGCACGT GGTCAACCTA 
0421 ACGCTAGTGG ATCTGCCCGG CATCACCAAG GTCCCGGTGG GCGATCAGCC GGAGGATATC 
0481 GAGGCGCAGA TCAAAGAATT  
 in silico PCR Fragment
0001 GAGGCCCTAA TTCCGGTCAT AAACAAGCTG CAGGACGTCT TCAACACCGT GGGCTCCGAC 
0061 TCCATCCAAT TGCCCCAAAT TGTTGTTCTA GGCAGTCAGA GCTCCGGCAA GAGTTCGGTG 
0121 ATCGAGAGCG TTGTGGGACG ATCCTTTCTG CCCCGTGGAA CTGGTATTGT GACCCGTCGC 
0181 CCACTGGTGC TCCAGCTGAT CTACAGCCCA CTCGATGATC GCGAGAATCG CTCGGCGGAA 
0241 AATGGTACGT CCAATGCCGA GGAGTGGGGC CGCTTCCTGC ACACCAAGAA GTGCTTCACG 
0301 GACTTTGACG AGATCCGCAA GGAGATCGAA AACGAAACGG AGCGGGCGGC GGGCAGCAAC 
0361 AAGGGCATCT GCCCGGAGCC CATCAACCTG AAGATATTCT CAACGCACGT GGTCAACCTA 
0421 ACGCTGGTGG ATCTGCCCGG CATCACCAAG GTCCCGGTGG GCGATCAGCC GGAGGATATC 
0481 GAGGCGCAGA TCAAAGAATT  
 Assemble Data

3210R-4.IR full       1   GNNGCCCTAATTCCGGTCATANACAAGCTGCAGGACGTCTTCAACACCGTGGGCTCCGAC 60
                          |  |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     1   GAGGCCCTAATTCCGGTCATAAACAAGCTGCAGGACGTCTTCAACACCGTGGGCTCCGAC 60


3210R-4.IR full       61  TCCATCCAATTGCCCCAAATTGTTGTTCTAGGCAGTCAGAGCTCCGGCAAGAGTTCGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     61  TCCATCCAATTGCCCCAAATTGTTGTTCTAGGCAGTCAGAGCTCCGGCAAGAGTTCGGTG 120


3210R-4.IR full       121 ATCGAGAGCGTTGTGGGACGATCCTTTCTGCCCCGTGGAACTGGTATTGTGACCCGTCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     121 ATCGAGAGCGTTGTGGGACGATCCTTTCTGCCCCGTGGAACTGGTATTGTGACCCGTCGC 180


3210R-4.IR full       181 CCACTGGTGCTCCAGCTGATCTACAGCCCACTCGATGATCGCGAGAATCGCTCGGCGGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     181 CCACTGGTGCTCCAGCTGATCTACAGCCCACTCGATGATCGCGAGAATCGCTCGGCGGAA 240


3210R-4.IR full       241 AATGGTACGTCCAATGCCGAGGAGTGGGGCCGCTTCCTGCACACCAAGAAGTGCTTCACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     241 AATGGTACGTCCAATGCCGAGGAGTGGGGCCGCTTCCTGCACACCAAGAAGTGCTTCACG 300


3210R-4.IR full       301 GACTTTGACGAGATCCGCAAGGAGATCGAAAACGAAACGGAGCGGGCGGCGGGCAGCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     301 GACTTTGACGAGATCCGCAAGGAGATCGAAAACGAAACGGAGCGGGCGGCGGGCAGCAAC 360


3210R-4.IR full       361 AAGGGCATCTGCCCGGAGCCCATCAACCTGAAGATATTCTCGATGCACGTGGTCAACCTA 420
                          ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
3210R-4.in silico     361 AAGGGCATCTGCCCGGAGCCCATCAACCTGAAGATATTCTCAACGCACGTGGTCAACCTA 420


3210R-4.IR full       421 ACGCTAGTGGATCTGCCCGGCATCACCAAGGTCCCGGTGGGCGATCAGCCGGAGGATATC 480
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-4.in silico     421 ACGCTGGTGGATCTGCCCGGCATCACCAAGGTCCCGGTGGGCGATCAGCCGGAGGATATC 480


3210R-4.IR full       481 GAGGCGCAGATCAAAGAATT 500
                          ||||||||||||||||||||
3210R-4.in silico     481 GAGGCGCAGATCAAAGAATT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.