National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3210R-3 
 Symbol Drp1  Full Name Dynamin related protein 1 
 CG No CG3210  Old CG No CG3210 
 Synonyms CG3210, Dnm1/Drp1, l(2)22Fc, l(2)ND2, l(2)ND3, unnamed, l(2)22Fd, Drp1, drp1, Drp, DRP1, frat, KG03815 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGCCCTAATTCCGGTCATA 
 Primer Seq. 3'
aatctagaggtaccAATTCTTTGATCTGCGCCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3210R-3.IR full       1   GNNGCCCTAATTCCGGTCATANACAAGCTGCAGGACGTCTTCAACACCGTGGGCTCCGAC 60
                          |  |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     1   GAGGCCCTAATTCCGGTCATAAACAAGCTGCAGGACGTCTTCAACACCGTGGGCTCCGAC 60


3210R-3.IR full       61  TCCATCCAATTGCCCCAAATTGTTGTTCTAGGCAGTCAGAGCTCCGGCAAGAGTTCGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     61  TCCATCCAATTGCCCCAAATTGTTGTTCTAGGCAGTCAGAGCTCCGGCAAGAGTTCGGTG 120


3210R-3.IR full       121 ATCGAGAGCGTTGTGGGACGATCCTTTCTGCCCCGTGGAACTGGTATTGTGACCCGTCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     121 ATCGAGAGCGTTGTGGGACGATCCTTTCTGCCCCGTGGAACTGGTATTGTGACCCGTCGC 180


3210R-3.IR full       181 CCACTGGTGCTCCAGCTGATCTACAGCCCACTCGATGATCGCGAGAATCGCTCGGCGGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     181 CCACTGGTGCTCCAGCTGATCTACAGCCCACTCGATGATCGCGAGAATCGCTCGGCGGAA 240


3210R-3.IR full       241 AATGGTACGTCCAATGCCGAGGAGTGGGGCCGCTTCCTGCACACCAAGAAGTGCTTCACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     241 AATGGTACGTCCAATGCCGAGGAGTGGGGCCGCTTCCTGCACACCAAGAAGTGCTTCACG 300


3210R-3.IR full       301 GACTTTGACGAGATCCGCAAGGAGATCGAAAACGAAACGGAGCGGGCGGCGGGCAGCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     301 GACTTTGACGAGATCCGCAAGGAGATCGAAAACGAAACGGAGCGGGCGGCGGGCAGCAAC 360


3210R-3.IR full       361 AAGGGCATCTGCCCGGAGCCCATCAACCTGAAGATATTCTCGATGCACGTGGTCAACCTA 420
                          ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
3210R-3.in silico     361 AAGGGCATCTGCCCGGAGCCCATCAACCTGAAGATATTCTCAACGCACGTGGTCAACCTA 420


3210R-3.IR full       421 ACGCTAGTGGATCTGCCCGGCATCACCAAGGTCCCGGTGGGCGATCAGCCGGAGGATATC 480
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
3210R-3.in silico     421 ACGCTGGTGGATCTGCCCGGCATCACCAAGGTCCCGGTGGGCGATCAGCCGGAGGATATC 480


3210R-3.IR full       481 GAGGCGCAGATCAAAGAATT 500
                          ||||||||||||||||||||
3210R-3.in silico     481 GAGGCGCAGATCAAAGAATT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.