National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32091R-2 
 Symbol CG32091  Full Name CG32091 
 CG No CG32091  Old CG No CG32091 
 Synonyms CG7346, CG14136, CG32091 
 Accession No (Link to NCBI) NM_168468.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCGTCAAGGAGCGCAAGAA 
 Primer Seq. 3'
aatctagaggtaccGCAGCAAACGGATGCACTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCGTCAAG NAGCGCAAGA ATTTCTGGCG CGTAACCGGT GAGCGTCGAA TTCTGAATGG 
0061 AGTCAGCGGC AGTTTCCGGA ATGGTCAACT TTCGGCAATC ATGGGACCCT CAGGAGCCGG 
0121 AAAAAGCAGT TTGCTTAATG CGATTTCGGG TTTCAGACGC GACGGAGTCA CNTGGGAACA 
0181 TCAAGATGAA GCGGGACAAT GCCTGCTATA TCACTCAGGA CGACCACCAC CAGACCCTGC 
0241 TGACTGTCGA GGAGCTTATG AATCTCGCCT GCGATCTCAA GTTAAAGAAT CGTCACAAAA 
0301 AGGCTGAAAT CATGACCGAT ATATTGGAGA ATCTGCACTT GAATCACCGT CGTAATGTGA 
0361 CGGCGGAGAA GTTGAGTGGC GGGGAGCGTA AGCGATTGTC CATCGCCCTG GAGCTGGTGG 
0421 ACAATCCAAA CATATTCTTC TTGGACGAAC CAACCAGTGG CCTGGACGAA GTGACAGCGG 
0481 CCCAGTGCAT CCGTTTGNTG C 
 in silico PCR Fragment
0001 CACCGTCAAG GAGCGCAAGA ATTTCTGGCG CGTAACCGGT GAGCGTCGAA TTCTGAATGG 
0061 AGTCAGCGGC AGTTTCCGGA ATGGTCAACT TTCGGCAATC ATGGGACCCT CAGGAGCCGG 
0121 AAAAAGCAGT TTGCTTAATG CGATTTCGGG TTTCAGACGC GACGGAGTCA C-TGGGAACA 
0181 TCAAGATGAA GCGGGACAAT GCCTGCTATA TCACTCAGGA CGACCACCAC CAGACCCTGC 
0241 TGACTGTCGA GGAGCTTATG AATCTCGCCT GCGATCTCAA GTTAAAGAAT CGTCACAAAA 
0301 AGGCTGAAAT CATGACCGAT ATATTGGAGA ATCTGCACTT GAATCACCGG CGCAATGTGA 
0361 CGGCAGAGAA GTTGAGTGGC GGGGAGCGTA AGCGATTGTC CATCGCCCTG GAGCTGGTGG 
0421 ACAATCCAAA CATATTCTTC TTGGACGAAC CAACCAGTGG CCTGGACGAA GTGACAGCGG 
0481 CCCAGTGCAT CCGTTTGCTG C 
 Assemble Data

32091R-2.IR_full       1   CACCGTCAAGNAGCGCAAGAATTTCTGGCGCGTAACCGGTGAGCGTCGAATTCTGAATGG 60
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     1   CACCGTCAAGGAGCGCAAGAATTTCTGGCGCGTAACCGGTGAGCGTCGAATTCTGAATGG 60


32091R-2.IR_full       61  AGTCAGCGGCAGTTTCCGGAATGGTCAACTTTCGGCAATCATGGGACCCTCAGGAGCCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     61  AGTCAGCGGCAGTTTCCGGAATGGTCAACTTTCGGCAATCATGGGACCCTCAGGAGCCGG 120


32091R-2.IR_full       121 AAAAAGCAGTTTGCTTAATGCGATTTCGGGTTTCAGACGCGACGGAGTCACNTGGGAACA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
32091R-2.in silico     121 AAAAAGCAGTTTGCTTAATGCGATTTCGGGTTTCAGACGCGACGGAGTCAC-TGGGAACA 180


32091R-2.IR_full       181 TCAAGATGAAGCGGGACAATGCCTGCTATATCACTCAGGACGACCACCACCAGACCCTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     181 TCAAGATGAAGCGGGACAATGCCTGCTATATCACTCAGGACGACCACCACCAGACCCTGC 240


32091R-2.IR_full       241 TGACTGTCGAGGAGCTTATGAATCTCGCCTGCGATCTCAAGTTAAAGAATCGTCACAAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     241 TGACTGTCGAGGAGCTTATGAATCTCGCCTGCGATCTCAAGTTAAAGAATCGTCACAAAA 300


32091R-2.IR_full       301 AGGCTGAAATCATGACCGATATATTGGAGAATCTGCACTTGAATCACCGTCGTAATGTGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||
32091R-2.in silico     301 AGGCTGAAATCATGACCGATATATTGGAGAATCTGCACTTGAATCACCGGCGCAATGTGA 360


32091R-2.IR_full       361 CGGCGGAGAAGTTGAGTGGCGGGGAGCGTAAGCGATTGTCCATCGCCCTGGAGCTGGTGG 420
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     361 CGGCAGAGAAGTTGAGTGGCGGGGAGCGTAAGCGATTGTCCATCGCCCTGGAGCTGGTGG 420


32091R-2.IR_full       421 ACAATCCAAACATATTCTTCTTGGACGAACCAACCAGTGGCCTGGACGAAGTGACAGCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32091R-2.in silico     421 ACAATCCAAACATATTCTTCTTGGACGAACCAACCAGTGGCCTGGACGAAGTGACAGCGG 480


32091R-2.IR_full       481 CCCAGTGCATCCGTTTGNTGC 501
                           ||||||||||||||||| |||
32091R-2.in silico     481 CCCAGTGCATCCGTTTGCTGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168468.1  CG32091-RB (CG32091), mRNA 
1.65   14  NM_078747.2  CG2969-RA, transcript variant A (Atet), mRNA 
1.65   14  NM_164580.1  CG2969-RB, transcript variant B (Atet), mRNA 
0.2   NM_167290.2  CG1697-RA, transcript variant A (rho-4), mRNA 
0.2   NM_167291.2  CG1697-RC, transcript variant C (rho-4), mRNA 
0.2   NM_080345.2  CG1697-RB, transcript variant B (rho-4), mRNA 
0   10  NM_134915.2  CG9664-RC, transcript variant C (CG9664), mRNA 
0   10  NM_164533.1  CG9664-RB, transcript variant B (CG9664), mRNA 
0   10  NM_164532.1  CG9664-RA, transcript variant A (CG9664), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_079755.1  CG6331-RA (Orct), mRNA 
0   NM_142049.2  CG9611-RB, transcript variant B (CG9611), mRNA 
0   NM_142048.1  CG14367-RA (CG14367), mRNA 
0   NM_169550.1  CG9611-RA, transcript variant A (CG9611), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_135175.2  CG9505-RA (CG9505), mRNA 
0   NM_168195.1  CG32387-RB, transcript variant B (CG32387), mRNA 
0   NM_001043123.1  CG32387-RC, transcript variant C (CG32387), mRNA 
0   NM_137837.1  CG3927-RA (CG3927), mRNA 
0   NM_137838.1  CG3875-RA (CG3875), mRNA 
0   NM_168196.1  CG32387-RA, transcript variant A (CG32387), mRNA 
0   NM_136926.1  CG13155-RA (CG13155), mRNA 
0   NM_057972.3  CG2917-RA (Orc4), mRNA 
0   NM_168897.1  CG32439-RA (CG32439), mRNA 
0   NM_058064.3  CG10206-RA (nop5), mRNA 
0   NM_167570.1  CG8465-RC, transcript variant C (l(1)G0222), mRNA 
0   NM_167569.1  CG8465-RB, transcript variant B (l(1)G0222), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
+- 
VM
+- 
VB
+- 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
++ 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.