National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32085R-2 
 Symbol CG32085  Full Name CG32085 
 CG No CG32085  Old CG No CG32085 
 Synonyms CG6060, CT33735, CG14134, BcDNA:RH06780, CG32085 
 Accession No (Link to NCBI) NM_168470.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCATCCGCGGAGTTGTCGAAGCGGATCAATGGCCTGGGCCTGCGCTCGAAGCACCATCA 60

                           ||||||||||||||||||||||||||||||||  |||||||||| ||||||||||||||| silico     61  TAGCAGCACATCCAGTGGTGCTGGTGGCGCCGGCGATGCTGCAT-CCCCGGCAGGAGCCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCCACTCCGGCAGCGCCCAGCGGCAAGACGTCGGTGATGGAGCGCGTAACGAACGCCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGTGCGGCGGTGGCAACTCAAATTCTAACTCAGGATCGAATAGCTCCAATAGCAACACCT 240

                           ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||| silico     241 CTTCAGCGTCTGCCACCGCTGCCACATCGCCCGCCAGCAACGCCAATCCTCCACA-GACG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     301 CCGGACAAACCGTCGCGTGGCAGTAGCCCCAGTCCCGGCGGTATCACAATGCCAGGTGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAGTCGCAGGTCCAGAACTCCACACACCACCTCCTGCAGCAGCAACAACAGCAACAGCAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATATGCAGCTGCAACAATCGCAGCAGCAGCATCTCCAGCTGCAAGCCTCCACGCTGATC 480

32085R-2.IR_full       481 AACTCCAACCACCATGTGATGG 502
                           |||||||||||||||||||||| silico     481 AACTCCAACCACCATGTGATGG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  29  NM_168470.1  CG32085-RA (CG32085), mRNA 
3.31   16  22  126  NM_080310.2  CG7952-RB (gt), mRNA 
3.11   15  14  99  307  NM_134474.4  CG32532-RA (CG32532), mRNA 
2.9   14  50  208  672  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.86   23  70  207  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
1.86   23  70  207  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
1.86   19  169  676  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.86   19  169  676  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.86   17  89  300  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
1.86   10  19  175  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
1.86   34  152  NM_168775.1  CG4059-RA, transcript variant A (ftz-f1), mRNA 
1.65   20  110  405  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
1.65   20  110  404  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
1.65   20  110  404  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
1.65   17  88  296  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
1.65   10  28  86  NM_136030.1  CG15157-RA (CG15157), mRNA 
1.65   33  139  NM_078509.2  CG3929-RA (dx), mRNA 
1.65   32  76  NM_142644.1  CG5466-RA (CG5466), mRNA 
1.45   27  61  307  NM_167239.2  CG32677-RA (CG32677), mRNA 
1.45   13  34  77  NM_135859.1  CG17341-RA (CG17341), mRNA 
1.45   87  191  NM_132004.2  CG4136-RA (CG4136), mRNA 
1.45   23  NM_169683.1  CG31291-RA, transcript variant A (CG31291), mRNA 
1.45   23  NM_169682.1  CG31291-RB, transcript variant B (CG31291), mRNA 
1.24   18  73  215  NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
1.24   14  56  86  NM_140884.2  CG8765-RA, transcript variant A (CG8765), mRNA 
1.24   14  56  86  NM_168807.2  CG8765-RB, transcript variant B (CG8765), mRNA 
1.24   26  191  NM_133012.2  CG32560-RA (CG32560), mRNA 
1.24   15  NM_168908.1  CG7199-RC, transcript variant C (Hr78), mRNA 
1.24   15  NM_168907.1  CG7199-RB, transcript variant B (Hr78), mRNA 
1.24   15  NM_079479.3  CG7199-RA, transcript variant A (Hr78), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.