National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32085R-2 
 Symbol CG32085  Full Name CG32085 
 CG No CG32085  Old CG No CG32085 
 Synonyms CG6060, CT33735, CG14134, BcDNA:RH06780, CG32085 
 Accession No (Link to NCBI) NM_168470.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCATCCGCGGAGTTGTCGAA 
 Primer Seq. 3'
aatctagaggtaccCCATCACATGGTGGTTGGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCATCCGCG NAGTTGTCGA AGCgGATCAA TGGCCTGGGc CTGCGCTCGA AGCACCATCA 
0061 TAGCAGCACA TCCAGTGGTG CTGGTGGCGC CGNNGATGCT GCATNCCCCG GCAGGAGCCA 
0121 CGCCCACTCC GGCAGCgCCC AGCGGCAAGA CGTCGGTGAT GGAGCGCGTA ACGAACGCCC 
0181 TGTGCGGCGG TGGCAACTCA AATTCTAACT CAGGATCGAA TAGCTCCAAT AGCAACACCT 
0241 CTTCAGCGTC TGCNACCGCT GCCACTTCGC CCGCCAGCAA CGCCAATCCT CCACANGACG 
0301 CCGGACAAAC CGTCGCGTgG CAGTAGCCCC AGTCCCGGCG GTATCACAAT NCCAGGTGGC 
0361 CAGTCGCAGG TCCAGAACTC CACACACCAC CTCCTGCAGC AGCAACAACA GCAACAGCAG 
0421 CATATGCAGC TGCAACAATC GCAGCAGCAG CATCTCCAGC TGCAAGCCTC CACGCTGATC 
0481 AACTCCAACC ACCATGTGAT GG 
 in silico PCR Fragment
0001 AGCATCCGCG GAGTTGTCGA AGCGGATCAA TGGCCTGGGC CTGCGCTCGA AGCACCATCA 
0061 TAGCAGCACA TCCAGTGGTG CTGGTGGCGC CGGCGATGCT GCAT-CCCCG GCAGGAGCCA 
0121 CGCCCACTCC GGCAGCGCCC AGCGGCAAGA CGTCGGTGAT GGAGCGCGTA ACGAACGCCC 
0181 TGTGCGGCGG TGGCAACTCA AATTCTAACT CAGGATCGAA TAGCTCCAAT AGCAACACCT 
0241 CTTCAGCGTC TGCCACCGCT GCCACATCGC CCGCCAGCAA CGCCAATCCT CCACA-GACG 
0301 CCGGACAAAC CGTCGCGTGG CAGTAGCCCC AGTCCCGGCG GTATCACAAT GCCAGGTGGC 
0361 CAGTCGCAGG TCCAGAACTC CACACACCAC CTCCTGCAGC AGCAACAACA GCAACAGCAG 
0421 CATATGCAGC TGCAACAATC GCAGCAGCAG CATCTCCAGC TGCAAGCCTC CACGCTGATC 
0481 AACTCCAACC ACCATGTGAT GG 
 Assemble Data

32085R-2.IR_full       1   AGCATCCGCGNAGTTGTCGAAGCGGATCAATGGCCTGGGCCTGCGCTCGAAGCACCATCA 60
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
32085R-2.in silico     1   AGCATCCGCGGAGTTGTCGAAGCGGATCAATGGCCTGGGCCTGCGCTCGAAGCACCATCA 60


32085R-2.IR_full       61  TAGCAGCACATCCAGTGGTGCTGGTGGCGCCGNNGATGCTGCATNCCCCGGCAGGAGCCA 120
                           ||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||
32085R-2.in silico     61  TAGCAGCACATCCAGTGGTGCTGGTGGCGCCGGCGATGCTGCAT-CCCCGGCAGGAGCCA 120


32085R-2.IR_full       121 CGCCCACTCCGGCAGCGCCCAGCGGCAAGACGTCGGTGATGGAGCGCGTAACGAACGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32085R-2.in silico     121 CGCCCACTCCGGCAGCGCCCAGCGGCAAGACGTCGGTGATGGAGCGCGTAACGAACGCCC 180


32085R-2.IR_full       181 TGTGCGGCGGTGGCAACTCAAATTCTAACTCAGGATCGAATAGCTCCAATAGCAACACCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32085R-2.in silico     181 TGTGCGGCGGTGGCAACTCAAATTCTAACTCAGGATCGAATAGCTCCAATAGCAACACCT 240


32085R-2.IR_full       241 CTTCAGCGTCTGCNACCGCTGCCACTTCGCCCGCCAGCAACGCCAATCCTCCACANGACG 300
                           ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||
32085R-2.in silico     241 CTTCAGCGTCTGCCACCGCTGCCACATCGCCCGCCAGCAACGCCAATCCTCCACA-GACG 300


32085R-2.IR_full       301 CCGGACAAACCGTCGCGTGGCAGTAGCCCCAGTCCCGGCGGTATCACAATNCCAGGTGGC 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
32085R-2.in silico     301 CCGGACAAACCGTCGCGTGGCAGTAGCCCCAGTCCCGGCGGTATCACAATGCCAGGTGGC 360


32085R-2.IR_full       361 CAGTCGCAGGTCCAGAACTCCACACACCACCTCCTGCAGCAGCAACAACAGCAACAGCAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32085R-2.in silico     361 CAGTCGCAGGTCCAGAACTCCACACACCACCTCCTGCAGCAGCAACAACAGCAACAGCAG 420


32085R-2.IR_full       421 CATATGCAGCTGCAACAATCGCAGCAGCAGCATCTCCAGCTGCAAGCCTCCACGCTGATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32085R-2.in silico     421 CATATGCAGCTGCAACAATCGCAGCAGCAGCATCTCCAGCTGCAAGCCTCCACGCTGATC 480


32085R-2.IR_full       481 AACTCCAACCACCATGTGATGG 502
                           ||||||||||||||||||||||
32085R-2.in silico     481 AACTCCAACCACCATGTGATGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  29  NM_168470.1  CG32085-RA (CG32085), mRNA 
3.31   16  22  126  NM_080310.2  CG7952-RB (gt), mRNA 
3.11   15  14  99  307  NM_134474.4  CG32532-RA (CG32532), mRNA 
2.9   14  50  208  672  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.86   23  70  207  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
1.86   23  70  207  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
1.86   19  169  676  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.86   19  169  676  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.86   17  89  300  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
1.86   10  19  175  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
1.86   34  152  NM_168775.1  CG4059-RA, transcript variant A (ftz-f1), mRNA 
1.65   20  110  405  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
1.65   20  110  404  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
1.65   20  110  404  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
1.65   17  88  296  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
1.65   10  28  86  NM_136030.1  CG15157-RA (CG15157), mRNA 
1.65   33  139  NM_078509.2  CG3929-RA (dx), mRNA 
1.65   32  76  NM_142644.1  CG5466-RA (CG5466), mRNA 
1.45   27  61  307  NM_167239.2  CG32677-RA (CG32677), mRNA 
1.45   13  34  77  NM_135859.1  CG17341-RA (CG17341), mRNA 
1.45   87  191  NM_132004.2  CG4136-RA (CG4136), mRNA 
1.45   23  NM_169683.1  CG31291-RA, transcript variant A (CG31291), mRNA 
1.45   23  NM_169682.1  CG31291-RB, transcript variant B (CG31291), mRNA 
1.24   18  73  215  NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
1.24   14  56  86  NM_140884.2  CG8765-RA, transcript variant A (CG8765), mRNA 
1.24   14  56  86  NM_168807.2  CG8765-RB, transcript variant B (CG8765), mRNA 
1.24   26  191  NM_133012.2  CG32560-RA (CG32560), mRNA 
1.24   15  NM_168908.1  CG7199-RC, transcript variant C (Hr78), mRNA 
1.24   15  NM_168907.1  CG7199-RB, transcript variant B (Hr78), mRNA 
1.24   15  NM_079479.3  CG7199-RA, transcript variant A (Hr78), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.