National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32068R-3 
 Symbol CG32068  Full Name CG32068 
 CG No CG32068  Old CG No CG32068 
 Synonyms CG8000, CG32068 
 Accession No (Link to NCBI) NM_168419.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCTGTACCAGAAGACCGGCG 
 Primer Seq. 3'
aatctagaggtaccCCGACTGATGCTTGATGTACG 
 Predicted Fragment Size
448 
 IR fragment full Seq
0001 ATCTGTACCA GAAGACCGGC GTGGAATACT TTAAGgcaaA TCAATGCGGA CGAGTACCAG 
0061 AGCGATAATA CCCTCACGGA ACTGAGGGCA AAACGTGGCT ACACCTACGA TGATGAGATC 
0121 ACATGCTCGG AAAAGTGCCT TCCAGACTAT GCCAACAAGT TGAAAGCCTT TTTTACCGAA 
0181 CACCTGCACA CGGATGAGGA AATTCGCCTG ATATTGGAGG GATCCGGTTA CTTTGATGTT 
0241 CGCGACAATG AGGACAACTG GTTGCGCATT AAGGTTGTCA AGGGAGATCT GATCATTATA 
0301 CCAGCTGGCA TATATCACCG CTTTACTTTG GATACCAATA ACTTTATCAG AACTCGTCGC 
0361 TATTTTGTGG GCGAACCTGT CTGGGCTCCA CACAATCGTC CTGCTGATGA TATGGACTGT 
0421 CGCAAATCGT ACATCAAGCA TCAGTCGG 
 in silico PCR Fragment
0001 ATCTGTACCA GAAGACCGGC GTGGAATACT TTAAGGCAAA TCAATGCGGA CGAGTACCAG 
0061 AGCGATAATA CCCTCACGGA ACTGAGGGCA AAACGTGGCT ACACCTACGA TGATGAGATC 
0121 ACATGCTCGG AAAAGTGCCT TCCAGACTAT GCCAACAAGT TGAAAGCCTT TTTCACCGAA 
0181 CACCTGCACA CGGATGAGGA AATTCGCCTG ATATTGGAGG GATCCGGTTA CTTTGATGTT 
0241 CGCGACAATG AGGACAACTG GTTGCGCATT AAGGTTGTCA AGGGAGATCT GATCATTATA 
0301 CCAGCTGGCA TATATCACCG CTTTACTTTG GATACCAATA ACTTTATCAG AACTCGTCGC 
0361 TATTTTGTGG GCGAACCTGT CTGGGCTCCA CACAATCGTC CTGCTGATGA AATGGACTGT 
0421 CGCAAATCGT ACATCAAGCA TCAGTCGG 
 Assemble Data

32068R-3.IR_full       1   ATCTGTACCAGAAGACCGGCGTGGAATACTTTAAGGCAAATCAATGCGGACGAGTACCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32068R-3.in silico     1   ATCTGTACCAGAAGACCGGCGTGGAATACTTTAAGGCAAATCAATGCGGACGAGTACCAG 60


32068R-3.IR_full       61  AGCGATAATACCCTCACGGAACTGAGGGCAAAACGTGGCTACACCTACGATGATGAGATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32068R-3.in silico     61  AGCGATAATACCCTCACGGAACTGAGGGCAAAACGTGGCTACACCTACGATGATGAGATC 120


32068R-3.IR_full       121 ACATGCTCGGAAAAGTGCCTTCCAGACTATGCCAACAAGTTGAAAGCCTTTTTTACCGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
32068R-3.in silico     121 ACATGCTCGGAAAAGTGCCTTCCAGACTATGCCAACAAGTTGAAAGCCTTTTTCACCGAA 180


32068R-3.IR_full       181 CACCTGCACACGGATGAGGAAATTCGCCTGATATTGGAGGGATCCGGTTACTTTGATGTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32068R-3.in silico     181 CACCTGCACACGGATGAGGAAATTCGCCTGATATTGGAGGGATCCGGTTACTTTGATGTT 240


32068R-3.IR_full       241 CGCGACAATGAGGACAACTGGTTGCGCATTAAGGTTGTCAAGGGAGATCTGATCATTATA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32068R-3.in silico     241 CGCGACAATGAGGACAACTGGTTGCGCATTAAGGTTGTCAAGGGAGATCTGATCATTATA 300


32068R-3.IR_full       301 CCAGCTGGCATATATCACCGCTTTACTTTGGATACCAATAACTTTATCAGAACTCGTCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32068R-3.in silico     301 CCAGCTGGCATATATCACCGCTTTACTTTGGATACCAATAACTTTATCAGAACTCGTCGC 360


32068R-3.IR_full       361 TATTTTGTGGGCGAACCTGTCTGGGCTCCACACAATCGTCCTGCTGATGATATGGACTGT 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
32068R-3.in silico     361 TATTTTGTGGGCGAACCTGTCTGGGCTCCACACAATCGTCCTGCTGATGAAATGGACTGT 420


32068R-3.IR_full       421 CGCAAATCGTACATCAAGCATCAGTCGG 448
                           ||||||||||||||||||||||||||||
32068R-3.in silico     421 CGCAAATCGTACATCAAGCATCAGTCGG 448

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   430  NM_168419.1  CG32068-RA (CG32068), mRNA 
0   NM_078699.2  CG1692-RA (mal), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_001042930.1  CG17490-RB, transcript variant B (CG17490), mRNA 
0   NM_169965.1  CG31233-RA (CG31233), mRNA 
0   NM_001042929.1  CG17490-RA, transcript variant A (CG17490), mRNA 
0   NM_142446.2  CG7142-RA (CG7142), mRNA 
0   NM_135286.1  CG6739-RA (CG6739), mRNA 
0   NM_166296.1  CG30332-RA (CG30332), mRNA 
0   NM_165083.2  CG31769-RA (CG31769), mRNA 
0   NM_079296.2  CG8019-RA (hay), mRNA 
0   NM_142371.1  CG14330-RA (CG14330), mRNA 
0   NM_141082.1  CG7166-RA (CG7166), mRNA 
0   NM_170400.1  CG31044-RA (CG31044), mRNA 
0   NM_136365.1  CG11212-RA (Ptr), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
0   NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
0   NM_137095.2  CG8415-RA (RpS23), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_135243.1  CG13775-RA (CG13775), mRNA 
0   NM_139425.1  CG5691-RA (CG5691), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_170492.1  CG31022-RA (PH4alphaEFB), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.