National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32068R-2 
 Symbol CG32068  Full Name CG32068 
 CG No CG32068  Old CG No CG32068 
 Synonyms CG8000, CG32068 
 Accession No (Link to NCBI) NM_168419.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCTGTACCAGAAGACCGGCGTGGAATACTTTAAGGCAAATCAATGCGGACGAGTACCAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCGATAATACCCTCACGGAACTGAGGGCAAAACGTGGCTACACCTACGATGATGAGATC 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     121 ACATGCTCGGAAAAGTGCCTTCCAGACTATGCCAACAAGTTGAAAGCCTTTTTCACCGAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACCTGCACACGGATGAGGAAATTCGCCTGATATTGGAGGGATCCGGTTACTTTGATGTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCGACAATGAGGACAACTGGTTGCGCATTAAGGTTGTCAAGGGAGATCTGATCATTATA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCAGCTGGCATATATCACCGCTTTACTTTGGATACCAATAACTTTATCAGAACTCGTCGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     361 TATTTTGTGGGCGAACCTGTCTGGGCTCCACACAATCGTCCTGCTGATGAAATGGACTGT 420

                           |||||||||||||||||||||||||||| silico     421 CGCAAATCGTACATCAAGCATCAGTCGG 448

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   430  NM_168419.1  CG32068-RA (CG32068), mRNA 
0   NM_078699.2  CG1692-RA (mal), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_001042930.1  CG17490-RB, transcript variant B (CG17490), mRNA 
0   NM_169965.1  CG31233-RA (CG31233), mRNA 
0   NM_001042929.1  CG17490-RA, transcript variant A (CG17490), mRNA 
0   NM_142446.2  CG7142-RA (CG7142), mRNA 
0   NM_135286.1  CG6739-RA (CG6739), mRNA 
0   NM_166296.1  CG30332-RA (CG30332), mRNA 
0   NM_165083.2  CG31769-RA (CG31769), mRNA 
0   NM_079296.2  CG8019-RA (hay), mRNA 
0   NM_142371.1  CG14330-RA (CG14330), mRNA 
0   NM_141082.1  CG7166-RA (CG7166), mRNA 
0   NM_170400.1  CG31044-RA (CG31044), mRNA 
0   NM_136365.1  CG11212-RA (Ptr), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
0   NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
0   NM_137095.2  CG8415-RA (RpS23), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_135243.1  CG13775-RA (CG13775), mRNA 
0   NM_139425.1  CG5691-RA (CG5691), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_170492.1  CG31022-RA (PH4alphaEFB), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.