National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32049R-1 
 Symbol CG33205  Full Name CG33205 
 CG No CG33205  Old CG No CG32049 
 Synonyms CG8154, CG8163, CG14172, CG32051, CG32049, BcDNA:RH19933, BcDNA:RE55923, CG33205 
 Accession No (Link to NCBI) NM_176312.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCGTCTTACGATGGCCAGCA 
 Primer Seq. 3'
aatctagaggtaccGCCATTTCAAATCTCCGCGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCGTCTTAC GATGGCCAGC AGCCTGGAGC ACAGTGGCAA CAGCAACAGC AGCAGCAGCA 
0061 GGTTCCGCAG CAGCAGTATC AGCCTCAATC GCAGGCTCAG GCGCCCTATC AGCCACCACA 
0121 GTGNAACCAG CCGCAGCAGC AGCAGCAGCA GCCANTCGTA CCAGGCTTCA CCGTACCAAC 
0181 AGCAGCAACA GCAACAGCCA TCCTATTACC CACAGCAAAA TGGTGGCTCG ACCNTATGCT 
0241 CAACCCCCAT ACAATTCTTA TTCGCAGCCC CAGTTGCCCT ACTCGCAGGA TCAGACTGAT 
0301 CTGCAGCAGC AGCAACAACA GCAGCAGCAG CAGTATCCGG GAgNCTACGC TGGCCAGGAT 
0361 AGCTANCGGG GCGCCAGTCC CGGCATCATC ACCCTGCGCA AGGAGGCTCC AGTCAGCCAG 
0421 AAGCCTGCAC CAGTCTACAC TTCGCAGCCA GCCGCCGTCA GTTATCAGGG AGGCAGCAAA 
0481 TTGCGCGGAG ATTTGAAATG GC 
 in silico PCR Fragment
0001 TCCGTCTTAC GATGGCCAGC AGCCTGGAGC ACAGTGGCAA CAGCAACAGC AGCAGCAGCA 
0061 GGTTCCGCAG CAGCAGTATC AGCCTCAATC GCAGGCTCAG GCGCCCTATC AGCCACCACA 
0121 GTGGAACCAG CCGCAGCAGC AGCAGCAGCA GCCA-TCGTA CCAGGCTTCA CCGTACCAAC 
0181 AGCAGCAACA GCAACAGCCA TCCTATTACC CACAGCAAAA TGGTGGCTCG ACC-TATGCT 
0241 CAACCCCCAT ACAATTCTTA TTCGCAGCCC CAGTTGCCCT ACTCGCAGGA TCAGACTGAT 
0301 CTGCAGCAGC AGCAACAACA GCAGCAGCAG CAGTATCCGG GAGCCTACGC TGGCCAGGAT 
0361 AGCTACCGGG GCGCCAGTCC CGGCATCATC ACCCTGCGCA AGGAGGCTCC AGTCAGCCAG 
0421 AAGCCTGCAC CAGTCTACAC TTCGCAGCCA GCCGCCGTCA GTTATCAGGG AGGCAGCAAA 
0481 TTGCGCGGAG ATTTGAAATG GC 
 Assemble Data

32049R-1.IR_full       1   TCCGTCTTACGATGGCCAGCAGCCTGGAGCACAGTGGCAACAGCAACAGCAGCAGCAGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32049R-1.in silico     1   TCCGTCTTACGATGGCCAGCAGCCTGGAGCACAGTGGCAACAGCAACAGCAGCAGCAGCA 60


32049R-1.IR_full       61  GGTTCCGCAGCAGCAGTATCAGCCTCAATCGCAGGCTCAGGCGCCCTATCAGCCACCACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32049R-1.in silico     61  GGTTCCGCAGCAGCAGTATCAGCCTCAATCGCAGGCTCAGGCGCCCTATCAGCCACCACA 120


32049R-1.IR_full       121 GTGNAACCAGCCGCAGCAGCAGCAGCAGCAGCCANTCGTACCAGGCTTCACCGTACCAAC 180
                           ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||
32049R-1.in silico     121 GTGGAACCAGCCGCAGCAGCAGCAGCAGCAGCCA-TCGTACCAGGCTTCACCGTACCAAC 180


32049R-1.IR_full       181 AGCAGCAACAGCAACAGCCATCCTATTACCCACAGCAAAATGGTGGCTCGACCNTATGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
32049R-1.in silico     181 AGCAGCAACAGCAACAGCCATCCTATTACCCACAGCAAAATGGTGGCTCGACC-TATGCT 240


32049R-1.IR_full       241 CAACCCCCATACAATTCTTATTCGCAGCCCCAGTTGCCCTACTCGCAGGATCAGACTGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32049R-1.in silico     241 CAACCCCCATACAATTCTTATTCGCAGCCCCAGTTGCCCTACTCGCAGGATCAGACTGAT 300


32049R-1.IR_full       301 CTGCAGCAGCAGCAACAACAGCAGCAGCAGCAGTATCCGGGAGNCTACGCTGGCCAGGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
32049R-1.in silico     301 CTGCAGCAGCAGCAACAACAGCAGCAGCAGCAGTATCCGGGAGCCTACGCTGGCCAGGAT 360


32049R-1.IR_full       361 AGCTANCGGGGCGCCAGTCCCGGCATCATCACCCTGCGCAAGGAGGCTCCAGTCAGCCAG 420
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
32049R-1.in silico     361 AGCTACCGGGGCGCCAGTCCCGGCATCATCACCCTGCGCAAGGAGGCTCCAGTCAGCCAG 420


32049R-1.IR_full       421 AAGCCTGCACCAGTCTACACTTCGCAGCCAGCCGCCGTCAGTTATCAGGGAGGCAGCAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32049R-1.in silico     421 AAGCCTGCACCAGTCTACACTTCGCAGCCAGCCGCCGTCAGTTATCAGGGAGGCAGCAAA 480


32049R-1.IR_full       481 TTGCGCGGAGATTTGAAATGGC 502
                           ||||||||||||||||||||||
32049R-1.in silico     481 TTGCGCGGAGATTTGAAATGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.2   483  50  258  517  NM_176309.2  CG33205-RC, transcript variant C (CG33205), mRNA 
100.2   483  50  258  517  NM_176308.2  CG33205-RB, transcript variant B (CG33205), mRNA 
100.2   483  50  258  517  NM_176312.2  CG33205-RA, transcript variant A (CG33205), mRNA 
100   482  26  154  308  NM_001038908.1  CG33205-RH, transcript variant H (CG33205), mRNA 
100   482  26  154  305  NM_176311.2  CG33205-RG, transcript variant G (CG33205), mRNA 
100   482  26  154  305  NM_176310.2  CG33205-RF, transcript variant F (CG33205), mRNA 
100   482  26  154  305  NM_176313.2  CG33205-RE, transcript variant E (CG33205), mRNA 
45.64   220  62  106  NM_001038909.1  CG33205-RI, transcript variant I (CG33205), mRNA 
26.76   129  961  2780  4797  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
26.76   129  961  2780  4797  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
26.76   129  961  2780  4797  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
11.41   55  354  1119  2336  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
11.41   55  354  1119  2336  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
8.92   43  222  745  1796  NM_135077.2  CG14023-RA (CG14023), mRNA 
8.5   41  162  548  1089  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
8.5   41  162  548  1089  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
8.5   41  162  548  1089  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
8.5   41  137  515  1073  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
8.5   41  96  397  768  NM_166992.2  CG2904-RA (ec), mRNA 
8.09   39  171  661  1146  NM_132246.2  CG10555-RA (CG10555), mRNA 
8.09   39  122  441  927  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
8.09   39  122  440  922  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
7.46   36  113  439  1131  NM_168179.1  CG32394-RA (CG32394), mRNA 
7.05   34  256  703  1499  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
7.05   34  256  703  1499  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
7.05   34  254  828  1821  NM_168571.2  CG32133-RA (CG32133), mRNA 
6.84   33  261  683  1597  NM_139493.2  CG2083-RA (CG2083), mRNA 
6.84   33  158  499  1119  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
6.84   33  93  327  430  NM_167054.1  CG12236-RA, transcript variant A (CG12236), mRNA 
6.84   33  93  327  429  NM_132049.3  CG12236-RB, transcript variant B (CG12236), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.