National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32005R-5 
 Symbol pan  Full Name pangolin 
 CG No CG34403  Old CG No CG32005 
 Synonyms FBgn0085432, CG32005, pan, dTCF, dTcf, l(4)13, Tcf, Tcf-1, TCF, DTCF, IA5, Pan, cTCF, LEF/TCF-1, LEF/TCF, Tcf/LEF, LEF-1, lethal 13, CG17964, l(4)102ABb, Lef, tcf, unnamed, pangolin, TCF/LEF, TCF/LEF1, DTcf, lef1, CG34403, PAN 
 Accession No (Link to NCBI) NM_166724.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCCACACAACTTTTATACGCTCGGCTTCTTCGGTCTCAGCTAGCTGAACGGGAATTTCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGAATAAATTCAACATGGTTCATTATTCGGGATCTAAAAAGACCATGCTTCGAGAAGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGAGCTTCTGTCAACCCCATCTTCGCAGGATAATAATAACAATATTAAGTTAATTAAAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TATCGAAAACAGCATAAGTTGTGTAGATCCCCCTTTGTTTGAATTTTCTAACGTTCATCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGAGCAGAACAAAAAAATAAACAAGACGACAAAAATTGTTACTCACCAAAATTAAAATC 300

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACAAGGAAGCCCTAGATGGGTACGACTTACAACACACGTGTGATTTTATCAGGGAGC- 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAAAAAACATTCTTATCGACATTAAAAAAAAACTAGATAATCTCTCAGATAGCTCAGGTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AATTTAGGAAAAGGTTAAGTGTACGTCAAAGTCACATTGAAGTAAATAATGGCTCTAATT 480

32005R-5.IR_full       481 CAGCCCTTGAGGAAAGTGTAA 501
                           ||||||||||||||||||||| silico     481 CAGCCCTTGAGGAAAGTGTAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166724.1  CG32005-RA (CG32005), mRNA 
0.2   NM_134958.2  CG10031-RA (CG10031), mRNA 
0   NM_165173.2  CG17161-RD, transcript variant D (grp), mRNA 
0   NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
0   NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_165172.2  CG17161-RC, transcript variant C (grp), mRNA 
0   NM_165171.2  CG17161-RB, transcript variant B (grp), mRNA 
0   NM_057663.3  CG17161-RA, transcript variant A (grp), mRNA 
0   NM_131991.2  CG3252-RA (CG3252), mRNA 
0   NM_079024.2  CG10246-RA (Cyp6a9), mRNA 
0   26  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   14  NM_001042805.1  CG34144-RA (CG34144), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_143636.1  CG2135-RA (CG2135), mRNA 
0   NM_170658.2  CG7826-RC, transcript variant C (mnb), mRNA 
0   NM_001014750.1  CG7826-RD, transcript variant D (mnb), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_168722.1  CG6512-RB, transcript variant B (CG6512), mRNA 
0   NM_168720.1  CG6512-RA, transcript variant A (CG6512), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_057690.2  CG8084-RA (ana), mRNA 
0   NM_130610.1  CG3600-RA (CG3600), mRNA 
0   NM_142314.2  CG10324-RA (CG10324), mRNA 
0   NM_001043069.1  CG34141-RA (CG34141), mRNA 
0   NM_132526.2  CG1967-RA (p24-1), mRNA 
0   NM_001015350.1  CG40085-PA.3 (CG40085), mRNA 
0   18  37  NM_141228.1  CG12001-RA (CG12001), mRNA 
0   15  NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.