National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32005R-2 
 Symbol pan  Full Name pangolin 
 CG No CG34403  Old CG No CG32005 
 Synonyms FBgn0085432, CG32005, pan, dTCF, dTcf, l(4)13, Tcf, Tcf-1, TCF, DTCF, IA5, Pan, cTCF, LEF/TCF-1, LEF/TCF, Tcf/LEF, LEF-1, lethal 13, CG17964, l(4)102ABb, Lef, tcf, unnamed, pangolin, TCF/LEF, TCF/LEF1, DTcf, lef1, CG34403, PAN 
 Accession No (Link to NCBI) NM_166724.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCACACAACTTTTATACGC 
 Primer Seq. 3'
aatctagaggtaccTTACACTTTCCTCAAGGGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGNCACACAA CTTTTATACG CTCGGCTTCT TCGGTCTCAG CTAGCTGAAC GGGAATTTCA 
0061 TTCGAATAAA TTCAACATGG TTCATTATTC GGGATCTAAA AAGACCATGC TTCGAGAAGA 
0121 TGAGCTTCTG TCAACCCCAT CTTCGCAGGA TAATAATAAC AATATTAAGT TAATTAAAGA 
0181 TATCGAAAAC AGCATAAGTT GTGTAGATCC CCCTTTGTTT GAATTTTCTA ACGTTCATCA 
0241 AAGAGCAGAA CAAAAAAATA AACAAGACGA CAAAAATTGT TACTCACCAA AATTAAAATC 
0301 GAACAAGGAA GCCCTAGATG GGTACGACTT ACAACACACG TGTGATTTTA TCAGGGAGCA 
0361 AAAAAAACAT TCTTATCGAC ATTAAAAAAA AACTAGATAA TCTCTCAGAT AGCTCAGGTA 
0421 AATTTAGGAA AAGGTTAAGT GTACGTCAAA GTCACATTGA AGTAAATAAT GGCTCTAATT 
0481 CAGCCCTTGA GGAAAGTGTA A 
 in silico PCR Fragment
0001 GGCCACACAA CTTTTATACG CTCGGCTTCT TCGGTCTCAG CTAGCTGAAC GGGAATTTCA 
0061 TTCGAATAAA TTCAACATGG TTCATTATTC GGGATCTAAA AAGACCATGC TTCGAGAAGA 
0121 TGAGCTTCTG TCAACCCCAT CTTCGCAGGA TAATAATAAC AATATTAAGT TAATTAAAGA 
0181 TATCGAAAAC AGCATAAGTT GTGTAGATCC CCCTTTGTTT GAATTTTCTA ACGTTCATCA 
0241 AAGAGCAGAA CAAAAAAATA AACAAGACGA CAAAAATTGT TACTCACCAA AATTAAAATC 
0301 GAACAAGGAA GCCCTAGATG GGTACGACTT ACAACACACG TGTGATTTTA TCAGGGAGC- 
0361 AAAAAAACAT TCTTATCGAC ATTAAAAAAA AACTAGATAA TCTCTCAGAT AGCTCAGGTA 
0421 AATTTAGGAA AAGGTTAAGT GTACGTCAAA GTCACATTGA AGTAAATAAT GGCTCTAATT 
0481 CAGCCCTTGA GGAAAGTGTA A 
 Assemble Data

32005R-2.IR_full       1   GGNCACACAACTTTTATACGCTCGGCTTCTTCGGTCTCAGCTAGCTGAACGGGAATTTCA 60
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     1   GGCCACACAACTTTTATACGCTCGGCTTCTTCGGTCTCAGCTAGCTGAACGGGAATTTCA 60


32005R-2.IR_full       61  TTCGAATAAATTCAACATGGTTCATTATTCGGGATCTAAAAAGACCATGCTTCGAGAAGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     61  TTCGAATAAATTCAACATGGTTCATTATTCGGGATCTAAAAAGACCATGCTTCGAGAAGA 120


32005R-2.IR_full       121 TGAGCTTCTGTCAACCCCATCTTCGCAGGATAATAATAACAATATTAAGTTAATTAAAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     121 TGAGCTTCTGTCAACCCCATCTTCGCAGGATAATAATAACAATATTAAGTTAATTAAAGA 180


32005R-2.IR_full       181 TATCGAAAACAGCATAAGTTGTGTAGATCCCCCTTTGTTTGAATTTTCTAACGTTCATCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     181 TATCGAAAACAGCATAAGTTGTGTAGATCCCCCTTTGTTTGAATTTTCTAACGTTCATCA 240


32005R-2.IR_full       241 AAGAGCAGAACAAAAAAATAAACAAGACGACAAAAATTGTTACTCACCAAAATTAAAATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     241 AAGAGCAGAACAAAAAAATAAACAAGACGACAAAAATTGTTACTCACCAAAATTAAAATC 300


32005R-2.IR_full       301 GAACAAGGAAGCCCTAGATGGGTACGACTTACAACACACGTGTGATTTTATCAGGGAGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
32005R-2.in silico     301 GAACAAGGAAGCCCTAGATGGGTACGACTTACAACACACGTGTGATTTTATCAGGGAGC- 360


32005R-2.IR_full       361 AAAAAAACATTCTTATCGACATTAAAAAAAAACTAGATAATCTCTCAGATAGCTCAGGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     361 AAAAAAACATTCTTATCGACATTAAAAAAAAACTAGATAATCTCTCAGATAGCTCAGGTA 420


32005R-2.IR_full       421 AATTTAGGAAAAGGTTAAGTGTACGTCAAAGTCACATTGAAGTAAATAATGGCTCTAATT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32005R-2.in silico     421 AATTTAGGAAAAGGTTAAGTGTACGTCAAAGTCACATTGAAGTAAATAATGGCTCTAATT 480


32005R-2.IR_full       481 CAGCCCTTGAGGAAAGTGTAA 501
                           |||||||||||||||||||||
32005R-2.in silico     481 CAGCCCTTGAGGAAAGTGTAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166724.1  CG32005-RA (CG32005), mRNA 
0.2   NM_134958.2  CG10031-RA (CG10031), mRNA 
0   NM_165173.2  CG17161-RD, transcript variant D (grp), mRNA 
0   NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
0   NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_165172.2  CG17161-RC, transcript variant C (grp), mRNA 
0   NM_165171.2  CG17161-RB, transcript variant B (grp), mRNA 
0   NM_057663.3  CG17161-RA, transcript variant A (grp), mRNA 
0   NM_131991.2  CG3252-RA (CG3252), mRNA 
0   NM_079024.2  CG10246-RA (Cyp6a9), mRNA 
0   26  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   14  NM_001042805.1  CG34144-RA (CG34144), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_143636.1  CG2135-RA (CG2135), mRNA 
0   NM_170658.2  CG7826-RC, transcript variant C (mnb), mRNA 
0   NM_001014750.1  CG7826-RD, transcript variant D (mnb), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_168722.1  CG6512-RB, transcript variant B (CG6512), mRNA 
0   NM_168720.1  CG6512-RA, transcript variant A (CG6512), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_057690.2  CG8084-RA (ana), mRNA 
0   NM_130610.1  CG3600-RA (CG3600), mRNA 
0   NM_142314.2  CG10324-RA (CG10324), mRNA 
0   NM_001043069.1  CG34141-RA (CG34141), mRNA 
0   NM_132526.2  CG1967-RA (p24-1), mRNA 
0   NM_001015350.1  CG40085-PA.3 (CG40085), mRNA 
0   18  37  NM_141228.1  CG12001-RA (CG12001), mRNA 
0   15  NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.