National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31960R-2 
 Symbol CG31960  Full Name CG31960 
 CG No CG31960  Old CG No CG31960 
 Synonyms CG10022, CG31960 
 Accession No (Link to NCBI) NM_164559.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0421 ACGCG 
 in silico PCR Fragment
0421 ACGCG 
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAAGAGCAGGACCTGCTCAAGAATATCTATAGCTTATTGGATAAGGATAACGAAGGTGCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCACCTCGAAGGAATTGGGAATGGTAATCCGAGCATTAGGTCGACAGCCCAATGAATCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGGTTCAGTCCATGATAAACGAGGTGGACTCTGATGGAAACGGATCCATTGCAAAGGAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGTTTTGCAATGTGATTCTGCGCAAGATGCACGACACAAATAAGGAGGAGGAGCTGCGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATGCGTTTCGCGTTTTTGATAAGGAAAACAATGGGTACATCTCCACTACCGAGCTGAGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCTGTCTTTATGGCACTTGGTGAAAAATTGGAAGACGACGAGCTGGAGGAGATGATACGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGTACGATTTAGATCAGGATAATCACATCAATTTCGAGGAGTTCACCAACATGATGACC 420

31960R-2.IR_full       421 ACGCG 425
                           ||||| silico     421 ACGCG 425

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   407  NM_164559.1  CG31960-RA (CG31960), mRNA 
58.23   237  83  31  NM_164560.1  CG31958-RA (CG31958), mRNA 
1.71   21  44  81  NM_136492.3  CG11165-RA (CG11165), mRNA 
0   NM_136414.1  CG12831-RA (CG12831), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_142144.2  CG3731-RB, transcript variant B (CG3731), mRNA 
0   NM_169607.1  CG3731-RA, transcript variant A (CG3731), mRNA 
0   NM_141849.1  CG14717-RA (CG14717), mRNA 
0   NM_137424.1  CG6362-RA (CG6362), mRNA 
0   NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_132198.2  CG1530-RA (CG1530), mRNA 
0   13  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   13  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   13  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   NM_078939.2  CG8251-RA, transcript variant A (Pgi), mRNA 
0   NM_165635.1  CG8251-RB, transcript variant B (Pgi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.