National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31960R-1 
 Symbol CG31960  Full Name CG31960 
 CG No CG31960  Old CG No CG31960 
 Synonyms CG10022, CG31960 
 Accession No (Link to NCBI) NM_164559.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAGAGCAGGACCTGCTCAAG 
 Primer Seq. 3'
aatctagaggtaccCGCGTGGTCATCATGTTGGTG 
 Predicted Fragment Size
425 
 IR fragment full Seq
0001 GAAGAGCAGG ACCTGCTCAA GAATATCTAT AGCTTATTGG ATAAGGATAA CGAAGGTGCC 
0061 ATCACCTCGA AGGAATTGGG AATGGTAATC CGAGCATTAG GTCGACAGCC CAATGAATCG 
0121 GAGGTTCAGT CCATGATAAA CGAGGTGGAC TCTGATGGAA ACGGATCCAT TGCAAAGGAG 
0181 GAGTTTTGCA ATGTGATTCT GCGCAAGATG CACGACACAA ATAAGGAGGA GGAGCTGCgC 
0241 GATGCGTTTC GCGTTTTTGA TAAGGAAAAC AATGGGTACA TCTCCACTAC CGAGCTGAGG 
0301 GCTGTCTTTA TGGCACTTGG TGAAAAATTG GAAGACGACG AGCTGGAGGA GATGATACGC 
0361 GAGTACGATT TAGATCAGGA TAATCACATC AATTTCGAGG AGTTCACCAA CATGATGACC 
0421 ACGCG 
 in silico PCR Fragment
0001 GAAGAGCAGG ACCTGCTCAA GAATATCTAT AGCTTATTGG ATAAGGATAA CGAAGGTGCC 
0061 ATCACCTCGA AGGAATTGGG AATGGTAATC CGAGCATTAG GTCGACAGCC CAATGAATCG 
0121 GAGGTTCAGT CCATGATAAA CGAGGTGGAC TCTGATGGAA ACGGATCCAT TGCAAAGGAG 
0181 GAGTTTTGCA ATGTGATTCT GCGCAAGATG CACGACACAA ATAAGGAGGA GGAGCTGCGC 
0241 GATGCGTTTC GCGTTTTTGA TAAGGAAAAC AATGGGTACA TCTCCACTAC CGAGCTGAGG 
0301 GCTGTCTTTA TGGCACTTGG TGAAAAATTG GAAGACGACG AGCTGGAGGA GATGATACGC 
0361 GAGTACGATT TAGATCAGGA TAATCACATC AATTTCGAGG AGTTCACCAA CATGATGACC 
0421 ACGCG 
 Assemble Data

31960R-1.IR_full       1   GAAGAGCAGGACCTGCTCAAGAATATCTATAGCTTATTGGATAAGGATAACGAAGGTGCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     1   GAAGAGCAGGACCTGCTCAAGAATATCTATAGCTTATTGGATAAGGATAACGAAGGTGCC 60


31960R-1.IR_full       61  ATCACCTCGAAGGAATTGGGAATGGTAATCCGAGCATTAGGTCGACAGCCCAATGAATCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     61  ATCACCTCGAAGGAATTGGGAATGGTAATCCGAGCATTAGGTCGACAGCCCAATGAATCG 120


31960R-1.IR_full       121 GAGGTTCAGTCCATGATAAACGAGGTGGACTCTGATGGAAACGGATCCATTGCAAAGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     121 GAGGTTCAGTCCATGATAAACGAGGTGGACTCTGATGGAAACGGATCCATTGCAAAGGAG 180


31960R-1.IR_full       181 GAGTTTTGCAATGTGATTCTGCGCAAGATGCACGACACAAATAAGGAGGAGGAGCTGCGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     181 GAGTTTTGCAATGTGATTCTGCGCAAGATGCACGACACAAATAAGGAGGAGGAGCTGCGC 240


31960R-1.IR_full       241 GATGCGTTTCGCGTTTTTGATAAGGAAAACAATGGGTACATCTCCACTACCGAGCTGAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     241 GATGCGTTTCGCGTTTTTGATAAGGAAAACAATGGGTACATCTCCACTACCGAGCTGAGG 300


31960R-1.IR_full       301 GCTGTCTTTATGGCACTTGGTGAAAAATTGGAAGACGACGAGCTGGAGGAGATGATACGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     301 GCTGTCTTTATGGCACTTGGTGAAAAATTGGAAGACGACGAGCTGGAGGAGATGATACGC 360


31960R-1.IR_full       361 GAGTACGATTTAGATCAGGATAATCACATCAATTTCGAGGAGTTCACCAACATGATGACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31960R-1.in silico     361 GAGTACGATTTAGATCAGGATAATCACATCAATTTCGAGGAGTTCACCAACATGATGACC 420


31960R-1.IR_full       421 ACGCG 425
                           |||||
31960R-1.in silico     421 ACGCG 425

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   407  NM_164559.1  CG31960-RA (CG31960), mRNA 
58.23   237  83  31  NM_164560.1  CG31958-RA (CG31958), mRNA 
1.71   21  44  81  NM_136492.3  CG11165-RA (CG11165), mRNA 
0   NM_136414.1  CG12831-RA (CG12831), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_142144.2  CG3731-RB, transcript variant B (CG3731), mRNA 
0   NM_169607.1  CG3731-RA, transcript variant A (CG3731), mRNA 
0   NM_141849.1  CG14717-RA (CG14717), mRNA 
0   NM_137424.1  CG6362-RA (CG6362), mRNA 
0   NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_132198.2  CG1530-RA (CG1530), mRNA 
0   13  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   13  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   13  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   NM_078939.2  CG8251-RA, transcript variant A (Pgi), mRNA 
0   NM_165635.1  CG8251-RB, transcript variant B (Pgi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.