National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31959R-1 
 Symbol CG31959  Full Name CG31959 
 CG No CG31959  Old CG No CG31959 
 Synonyms CG10020, CG31959 
 Accession No (Link to NCBI) NM_164555.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGCACAAACAGAGCATCGT 
 Primer Seq. 3'
aatctagaggtaccACCCGATTTACCAGTACTCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGGCACAAA CAGAGCATCG TCAACATCAA CGACTGGAAC TGGTCTGCAT CATGCTGTGT 
0061 CATTGGGCAA CATTGAGGTC TCCACCAAGA CCACCTACTC CAGCCACATG GATCGCAGCT 
0121 ACGACTCCGA GGATGAACAC ACTGGTCGCC GAAGACTTCG CCATACGCTG TCCACCGAGT 
0181 TGCATCCTCA CACTTCTNGT TTACTCACGC GGAGATATTC GGGAACAGTA CTGCCTCACA 
0241 GATCGCCAGT TGCACAGCAT AGAGCAGCGT CCTAGGCGAG AACGATTTTT TGGCTGCCTT 
0301 TCGCGACGCG GTCAAACGCA ATCGGGCAGT TTTTTGGGCG GCTGTGTGGG TCGGCGGGTG 
0361 CCCTCCGATG AGAATTTGGN CNCCTATGCT CCATTTGAAA AATATCCACG CTACCAGAAC 
0421 AGCTATACGG ACACACACGA ATTGGAAAGT TCGCTATTTT cGCCGTCAAC CGGCCTCGAT 
0481 TCTGAGTACT GGTAAATCGG GT 
 in silico PCR Fragment
0001 GTGGCACAAA CAGAGCATCG TCAACATCAA CGACTGGAAC TGGTCTGCAT CATGCTGTGT 
0061 CATTGGGCAA CATTGAGGTC TCCACCAAGA CCACCTACTC CAGCCACATG GATCGCAGCT 
0121 ACGACTCCGA GGATGAACAC ACTGGTCGCC GAAGACTTCG CCATACGCTG TCCACCGAGT 
0181 TGCATCCTCA CACTTCT-GT TTACTCACGC GGAGATATTC GGGAACAGTA CTGCCTCACA 
0241 GATCGCCAGT TGCACAGCAT AGAGCAGCGT CCTAGGCGAG AACGATTTTT TGGCTGCCTT 
0301 TCGCGACGCG GTCAAACGCA ATCGGGCAGT TTTTTGGGCG GCTGTGTGGG TCGGCGGGTG 
0361 CCCTCCGATG AGAATTTGGC CGCCTATGCT CCATTTGAAA AATATCCACG CTACCAGAAC 
0421 AGCTATACGG ACACACACGA ATTGGAAAGT TC-CTATTTT CGCCGTCAAC CGGCCTCGAT 
0481 TCTGAGTACT GGTAAATCGG GT 
 Assemble Data

31959R-1.IR_full        1   TGGCACAAACAGAGCATCGTCAACATCAACGACTGGAACTGGTCTGCATCATGCTGTGT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico      1   TGGCACAAACAGAGCATCGTCAACATCAACGACTGGAACTGGTCTGCATCATGCTGTGT 59


31959R-1.IR_full       61  CATTGGGCAACATTGAGGTCTCCACCAAGACCACCTACTCCAGCCACATGGATCGCAGCT 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     61  CATTGGGCAACATTGAGGTCTCCACCAAGACCACCTACTCCAGCCACATGGATCGCAGCT 119


31959R-1.IR_full       121 ACGACTCCGAGGATGAACACACTGGTCGCCGAAGACTTCGCCATACGCTGTCCACCGAGT 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     121 ACGACTCCGAGGATGAACACACTGGTCGCCGAAGACTTCGCCATACGCTGTCCACCGAGT 179


31959R-1.IR_full       181 TGCATCCTCACACTTCTNGTTTACTCACGCGGAGATATTCGGGAACAGTACTGCCTCACA 239
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     181 TGCATCCTCACACTTCT-GTTTACTCACGCGGAGATATTCGGGAACAGTACTGCCTCACA 239


31959R-1.IR_full       241 GATCGCCAGTTGCACAGCATAGAGCAGCGTCCTAGGCGAGAACGATTTTTTGGCTGCCTT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     241 GATCGCCAGTTGCACAGCATAGAGCAGCGTCCTAGGCGAGAACGATTTTTTGGCTGCCTT 299


31959R-1.IR_full       301 TCGCGACGCGGTCAAACGCAATCGGGCAGTTTTTTGGGCGGCTGTGTGGGTCGGCGGGTG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     301 TCGCGACGCGGTCAAACGCAATCGGGCAGTTTTTTGGGCGGCTGTGTGGGTCGGCGGGTG 359


31959R-1.IR_full       361 CCCTCCGATGAGAATTTGGNCNCCTATGCTCCATTTGAAAAATATCCACGCTACCAGAAC 419
                           ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||
31959R-1.in silico     361 CCCTCCGATGAGAATTTGGCCGCCTATGCTCCATTTGAAAAATATCCACGCTACCAGAAC 419


31959R-1.IR_full       421 AGCTATACGGACACACACGAATTGGAAAGTTCGCTATTTTCGCCGTCAACCGGCCTCGAT 479
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
31959R-1.in silico     421 AGCTATACGGACACACACGAATTGGAAAGTTC-CTATTTTCGCCGTCAACCGGCCTCGAT 479


31959R-1.IR_full       481 TCTGAGTACTGGTAAATCGGGT 501
                           ||||||||||||||||||||||
31959R-1.in silico     481 TCTGAGTACTGGTAAATCGGGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164555.1  CG31959-RB (CG31959), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
0   NM_001038926.1  CG33261-RI, transcript variant I (Trl), mRNA 
0   NM_078561.2  CG1641-RA (sisA), mRNA 
0   NM_142667.1  CG17275-RA (CG17275), mRNA 
0   NM_141847.2  CG6834-RA (CG6834), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_144182.1  CG14162-RA (dpr6), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
0   NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 
0   NM_139395.1  CG12035-RA (CG12035), mRNA 
0   NM_138204.2  CG17129-RA, transcript variant A (CG17129), mRNA 
0   NM_167837.1  CG17129-RB, transcript variant B (CG17129), mRNA 
0   NM_167838.1  CG17129-RC, transcript variant C (CG17129), mRNA 
0   NM_176299.1  CG33057-RA, transcript variant A (CG33057), mRNA 
0   NM_168272.1  CG7163-RA, transcript variant A (mkg-p), mRNA 
0   NM_139962.3  CG7163-RB, transcript variant B (mkg-p), mRNA 
0   NM_166934.1  CG3191-RA (CG3191), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_057789.3  CG6720-RA, transcript variant A (UbcD2), mRNA 
0   NM_164943.1  CG6720-RB, transcript variant B (UbcD2), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_079627.2  CG3351-RA (mRpL11), mRNA 
0   11  NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.