National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3193R-2 
 Symbol crn  Full Name crooked neck 
 CG No CG3193  Old CG No CG3193 
 Synonyms EG:30B8.1, CG3193, yok, l30, RC63, l(1)2, l(1)CRN, N10, N5, 62D9.a, CG18842, l(1)crn, l(1)N7, l(1)2Fa, CDC16, crn 
 Accession No (Link to NCBI) NM_057770.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     1   TGCCCAAGGTGGCCAAGGTCAAAAACAAAGCGCCGGCGGAGGTGCAAATTACGGCG-GAG 60

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     61  CAGTTGCTCCGTGAGGCCAAGGAGCGAGATCTGGAGA-TTCTGCCGCCGCCGCCAAAGCA 120

                          |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAAGATCTCCGA-TCCCGCCGAGTTGGCAGACTATCAGCAGCGGAAGCGAAAGACCTTCG 180

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     181 AGGACAATCTCCGCAAGAACCGCATGGTAGTCAGCCATTGGATCAAATATGCTCAGTGGG 240

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     241 AGGAGCAGCAGCAGGAGAT-CCAGCGGGCGCGCTCTATCTGGGAGCGGGCGTTGGACAAT 300

                          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     301 GAGCACCGGAACGTGACCCTCTGGCTGAAATACGCCGAGATGGAGATGAAGAACAAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGAATCATGCTCGCAATCTGTGGGATCGGGCAGTGACCATCATGCCGCGAGTCAACCAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTCTGGTACAAGTACACCTACATGGAGGAGATGCTGGAGAATGTGGCAGGGGCGCGACAG 480

3193R-2.IR_full       481 GTGTTCGAGCGCTGGATGGAGTGG 504
                          |||||||||||||||||||||||| silico     481 GTGTTCGAGCGCTGGATGGAGTGG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057770.3  CG3193-RA (crn), mRNA 
0.62   NM_135505.2  CG4839-RA, transcript variant A (CG4839), mRNA 
0.62   NM_164890.1  CG4839-RB, transcript variant B (CG4839), mRNA 
0.2   NM_132343.2  CG3002-RB (Gga), mRNA 
0.2   NM_167230.1  CG32683-RA (CG32683), mRNA 
0   NM_078607.2  CG6157-RA (dah), mRNA 
0   NM_131982.1  CG3323-RA (CG3323), mRNA 
0   NM_080201.1  CG10528-RA, transcript variant A (fs(2)ltoPP43), mRNA 
0   NM_176062.1  CG10528-RB, transcript variant B (fs(2)ltoPP43), mRNA 
0   NM_139600.3  CG14995-RB, transcript variant B (CG14995), mRNA 
0   NM_168059.2  CG14995-RA, transcript variant A (CG14995), mRNA 
0   NM_168058.2  CG14995-RC, transcript variant C (CG14995), mRNA 
0   NM_168057.2  CG14995-RD, transcript variant D (CG14995), mRNA 
0   NM_132322.2  CG15797-RA (ric8a), mRNA 
0   NR_002558.1  CG15797-RA (ric8a), mRNA, mRNA 
0   23  NM_144119.2  CG33466-RA (Fs), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_170198.2  CG11839-RA (CG11839), mRNA 
0   NM_140277.1  CG17824-RA (CG17824), mRNA 
0   22  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   10  NM_137750.1  CG10321-RA (CG10321), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   NM_141577.2  CG11776-RA (CG11776), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_132229.1  CG2278-RA (CG2278), mRNA 
0   NM_166465.1  CG9856-RA (PTP-ER), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.