National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3193R-1 
 Symbol crn  Full Name crooked neck 
 CG No CG3193  Old CG No CG3193 
 Synonyms EG:30B8.1, CG3193, yok, l30, RC63, l(1)2, l(1)CRN, N10, N5, 62D9.a, CG18842, l(1)crn, l(1)N7, l(1)2Fa, CDC16, crn 
 Accession No (Link to NCBI) NM_057770.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCCAAGGTGGCCAAGGTCA 
 Primer Seq. 3'
aatctagaggtaccCCACTCCATCCAGCGCTCGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGcCCAAGGT GGCCAAGGTC AAAAACAAAG CGCCGGCGGA GGTGCAAATT ACGGCGCGAG 
0061 CAGTTGCTCC GTGAGGCCAA GGAGCGAGAT CTGGAGATTT CTGCCGCCGC CGCCAAAGCA 
0121 GAAGATCTCC GATTCCCGCC GAGTTGGCAG ACTATCAGCA GCGGAAGCGA AAGACCTTCG 
0181 AGGACAATCT CCGCAAGAAC CGCATGGTTG TCAGCCATTG GATCAAATAT GCTCAGTGGG 
0241 AGGAGCAGCA GCAGGAGATN CCAGCGGGCG CGCTCTATCT GGGAGCGGGC GTTGGACAAT 
0301 GAGCACCGGA ACGTGACNCT CTGGCTGAAA TACGCCGAGA TGGAGATGAA GAACAAGCAG 
0361 GTGAATCATG CTCGCAATCT GTGGGATCGG GCAGTGACCA TCATGCCGCG AGTCAACCAG 
0421 TTCTGGTACA AGTACACCTA CATGGAGGAG ATGCTGGAGA ATGTGGCAGG GGCGCGACAG 
0481 GTGTTCGAGC GCTGGATGGA GTGG 
 in silico PCR Fragment
0001 TGCCCAAGGT GGCCAAGGTC AAAAACAAAG CGCCGGCGGA GGTGCAAATT ACGGCG-GAG 
0061 CAGTTGCTCC GTGAGGCCAA GGAGCGAGAT CTGGAGA-TT CTGCCGCCGC CGCCAAAGCA 
0121 GAAGATCTCC GA-TCCCGCC GAGTTGGCAG ACTATCAGCA GCGGAAGCGA AAGACCTTCG 
0181 AGGACAATCT CCGCAAGAAC CGCATGGTAG TCAGCCATTG GATCAAATAT GCTCAGTGGG 
0241 AGGAGCAGCA GCAGGAGAT- CCAGCGGGCG CGCTCTATCT GGGAGCGGGC GTTGGACAAT 
0301 GAGCACCGGA ACGTGACCCT CTGGCTGAAA TACGCCGAGA TGGAGATGAA GAACAAGCAG 
0361 GTGAATCATG CTCGCAATCT GTGGGATCGG GCAGTGACCA TCATGCCGCG AGTCAACCAG 
0421 TTCTGGTACA AGTACACCTA CATGGAGGAG ATGCTGGAGA ATGTGGCAGG GGCGCGACAG 
0481 GTGTTCGAGC GCTGGATGGA GTGG 
 Assemble Data

3193R-1.IR_full       1   TGCCCAAGGTGGCCAAGGTCAAAAACAAAGCGCCGGCGGAGGTGCAAATTACGGCGCGAG 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
3193R-1.in silico     1   TGCCCAAGGTGGCCAAGGTCAAAAACAAAGCGCCGGCGGAGGTGCAAATTACGGCG-GAG 60


3193R-1.IR_full       61  CAGTTGCTCCGTGAGGCCAAGGAGCGAGATCTGGAGATTTCTGCCGCCGCCGCCAAAGCA 120
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
3193R-1.in silico     61  CAGTTGCTCCGTGAGGCCAAGGAGCGAGATCTGGAGA-TTCTGCCGCCGCCGCCAAAGCA 120


3193R-1.IR_full       121 GAAGATCTCCGATTCCCGCCGAGTTGGCAGACTATCAGCAGCGGAAGCGAAAGACCTTCG 180
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
3193R-1.in silico     121 GAAGATCTCCGA-TCCCGCCGAGTTGGCAGACTATCAGCAGCGGAAGCGAAAGACCTTCG 180


3193R-1.IR_full       181 AGGACAATCTCCGCAAGAACCGCATGGTTGTCAGCCATTGGATCAAATATGCTCAGTGGG 240
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3193R-1.in silico     181 AGGACAATCTCCGCAAGAACCGCATGGTAGTCAGCCATTGGATCAAATATGCTCAGTGGG 240


3193R-1.IR_full       241 AGGAGCAGCAGCAGGAGATNCCAGCGGGCGCGCTCTATCTGGGAGCGGGCGTTGGACAAT 300
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
3193R-1.in silico     241 AGGAGCAGCAGCAGGAGAT-CCAGCGGGCGCGCTCTATCTGGGAGCGGGCGTTGGACAAT 300


3193R-1.IR_full       301 GAGCACCGGAACGTGACNCTCTGGCTGAAATACGCCGAGATGGAGATGAAGAACAAGCAG 360
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
3193R-1.in silico     301 GAGCACCGGAACGTGACCCTCTGGCTGAAATACGCCGAGATGGAGATGAAGAACAAGCAG 360


3193R-1.IR_full       361 GTGAATCATGCTCGCAATCTGTGGGATCGGGCAGTGACCATCATGCCGCGAGTCAACCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3193R-1.in silico     361 GTGAATCATGCTCGCAATCTGTGGGATCGGGCAGTGACCATCATGCCGCGAGTCAACCAG 420


3193R-1.IR_full       421 TTCTGGTACAAGTACACCTACATGGAGGAGATGCTGGAGAATGTGGCAGGGGCGCGACAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3193R-1.in silico     421 TTCTGGTACAAGTACACCTACATGGAGGAGATGCTGGAGAATGTGGCAGGGGCGCGACAG 480


3193R-1.IR_full       481 GTGTTCGAGCGCTGGATGGAGTGG 504
                          ||||||||||||||||||||||||
3193R-1.in silico     481 GTGTTCGAGCGCTGGATGGAGTGG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057770.3  CG3193-RA (crn), mRNA 
0.62   NM_135505.2  CG4839-RA, transcript variant A (CG4839), mRNA 
0.62   NM_164890.1  CG4839-RB, transcript variant B (CG4839), mRNA 
0.2   NM_132343.2  CG3002-RB (Gga), mRNA 
0.2   NM_167230.1  CG32683-RA (CG32683), mRNA 
0   NM_078607.2  CG6157-RA (dah), mRNA 
0   NM_131982.1  CG3323-RA (CG3323), mRNA 
0   NM_080201.1  CG10528-RA, transcript variant A (fs(2)ltoPP43), mRNA 
0   NM_176062.1  CG10528-RB, transcript variant B (fs(2)ltoPP43), mRNA 
0   NM_139600.3  CG14995-RB, transcript variant B (CG14995), mRNA 
0   NM_168059.2  CG14995-RA, transcript variant A (CG14995), mRNA 
0   NM_168058.2  CG14995-RC, transcript variant C (CG14995), mRNA 
0   NM_168057.2  CG14995-RD, transcript variant D (CG14995), mRNA 
0   NM_132322.2  CG15797-RA (ric8a), mRNA 
0   NR_002558.1  CG15797-RA (ric8a), mRNA, mRNA 
0   23  NM_144119.2  CG33466-RA (Fs), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_170198.2  CG11839-RA (CG11839), mRNA 
0   NM_140277.1  CG17824-RA (CG17824), mRNA 
0   22  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   10  NM_137750.1  CG10321-RA (CG10321), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   NM_141577.2  CG11776-RA (CG11776), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_132229.1  CG2278-RA (CG2278), mRNA 
0   NM_166465.1  CG9856-RA (PTP-ER), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.