National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31935R-3 
 Symbol CG31935  Full Name CG31935 
 CG No CG31935  Old CG No CG31935 
 Synonyms CG7373, CG10870, CG31935, AAF51358 
 Accession No (Link to NCBI) NM_134764.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCCGAAGAAATCGACGATA 
 Primer Seq. 3'
aatctagaggtaccCTGAACTTCGGCAGACACAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCCGAAGA AATCGACGAT AACGAGTTTT ACCGGGAGAA CTTCAGTGCG GATTCCGACT 
0061 GGGAGGTGTT NCAACGCCCA GCTGGGCGAA ATCCTTCAAA AATGGGACGT ATCGTCGGAT 
0121 TCCGAGACCA GAAATCTTAA ATCCGAAGAA ATCTTCAGCT GCAATTGGAA GGTGGAGCGG 
0181 GAGAAGCTGG ACATGTTGAG GAATGGCATT GAGGTGGAGT ATCACCAGGC CATACTGGAG 
0241 GATGAGGAAC TCGTCAGAGC GGAGGCGAAG GAGATCACCT GCCTGCAACG CACCAGTTGC 
0301 CACCATGATC TCATGTCCAC TGGGAATAGC TTTGGTCCTC CAATAAGAAG CTCACAGGAG 
0361 CTGCACATTC TGGCCAGGAT CTACGGGCTA AGGAGGTTCA TTGTCCTGCA CCCCGTGAAT 
0421 CCAACTCTGA ACTACATGAG GTCCACCTCG GAGTTCAACT TCTTCCTGAG CGNCGTCGCC 
0481 GTTGTGTCTG CCGAAGTTCA G 
 in silico PCR Fragment
0001 TGGCCGAAGA AATCGACGAT AACGAGTTTT ACCGGGAGAA CTTCAGTGCG GATTCCGACT 
0061 GGGAGGTGTT -CAACGCCCA GCTGGGCGAA ATCCTTCAAA AATGGGACGT ATCGTCGGAT 
0121 TCCGAGACCA GAAATCTTAA ATCCGAAGAA ATCTTCAGCT GCAATTGGAA GGTGGAGCGG 
0181 GAGAAGCTGG ACATGTTGAG GAATGGCATT GAGGTGGAGT ATCACCAGGC CATACTGGAG 
0241 GATGAGGAAC TCGTCAGAGC GGAGGCGAAG GAGATCACCT GCCTGCAACG CACCAGTTGC 
0301 CACCATGATC TCATGTCCAC TGGGAATAGC TTTGGTCCTC CAATAAGAAG CTCACAGGAG 
0361 CTGCACATTC TGGCCAGGAT CTACGGGCTA AGGAGGTTCA TTGTCCTGCA CCCCGTGAAT 
0421 CCAACTCTGA ACTACATGAG GTCCACCTCG GAGTTCAACT TCTTCCTGAG CGCCGTCGCC 
0481 GTTGTGTCTG CCGAAGTTCA G 
 Assemble Data

31935R-3.IR_full       1   TGGCCGAAGAAATCGACGATAACGAGTTTTACCGGGAGAACTTCAGTGCGGATTCCGACT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     1   TGGCCGAAGAAATCGACGATAACGAGTTTTACCGGGAGAACTTCAGTGCGGATTCCGACT 60


31935R-3.IR_full       61  GGGAGGTGTTNCAACGCCCAGCTGGGCGAAATCCTTCAAAAATGGGACGTATCGTCGGAT 120
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     61  GGGAGGTGTT-CAACGCCCAGCTGGGCGAAATCCTTCAAAAATGGGACGTATCGTCGGAT 120


31935R-3.IR_full       121 TCCGAGACCAGAAATCTTAAATCCGAAGAAATCTTCAGCTGCAATTGGAAGGTGGAGCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     121 TCCGAGACCAGAAATCTTAAATCCGAAGAAATCTTCAGCTGCAATTGGAAGGTGGAGCGG 180


31935R-3.IR_full       181 GAGAAGCTGGACATGTTGAGGAATGGCATTGAGGTGGAGTATCACCAGGCCATACTGGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     181 GAGAAGCTGGACATGTTGAGGAATGGCATTGAGGTGGAGTATCACCAGGCCATACTGGAG 240


31935R-3.IR_full       241 GATGAGGAACTCGTCAGAGCGGAGGCGAAGGAGATCACCTGCCTGCAACGCACCAGTTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     241 GATGAGGAACTCGTCAGAGCGGAGGCGAAGGAGATCACCTGCCTGCAACGCACCAGTTGC 300


31935R-3.IR_full       301 CACCATGATCTCATGTCCACTGGGAATAGCTTTGGTCCTCCAATAAGAAGCTCACAGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     301 CACCATGATCTCATGTCCACTGGGAATAGCTTTGGTCCTCCAATAAGAAGCTCACAGGAG 360


31935R-3.IR_full       361 CTGCACATTCTGGCCAGGATCTACGGGCTAAGGAGGTTCATTGTCCTGCACCCCGTGAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31935R-3.in silico     361 CTGCACATTCTGGCCAGGATCTACGGGCTAAGGAGGTTCATTGTCCTGCACCCCGTGAAT 420


31935R-3.IR_full       421 CCAACTCTGAACTACATGAGGTCCACCTCGGAGTTCAACTTCTTCCTGAGCGNCGTCGCC 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
31935R-3.in silico     421 CCAACTCTGAACTACATGAGGTCCACCTCGGAGTTCAACTTCTTCCTGAGCGCCGTCGCC 480


31935R-3.IR_full       481 GTTGTGTCTGCCGAAGTTCAG 501
                           |||||||||||||||||||||
31935R-3.in silico     481 GTTGTGTCTGCCGAAGTTCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134764.2  CG31935-RA (CG31935), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_136878.2  CG8364-RB, transcript variant B (Rep3), mRNA 
0   NM_136879.2  CG8364-RA, transcript variant A (Rep3), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   NM_132743.4  CG14408-RA, transcript variant A (CG14408), mRNA 
0   NM_001038755.1  CG14408-RC, transcript variant C (CG14408), mRNA 
0   NM_080089.2  CG10842-RA (Cyp4p1), mRNA 
0   NM_058028.3  CG4585-RA (CG4585), mRNA 
0   NM_135161.1  CG9486-RA (CG9486), mRNA 
0   NM_135154.1  CG9227-RA (tectonic), mRNA 
0   NM_132301.3  CG7065-RA (CG7065), mRNA 
0   NM_169225.1  CG31259-RA (CG31259), mRNA 
0   NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_167652.1  CG3400-RD, transcript variant D (Pfrx), mRNA 
0   NM_167655.1  CG3400-RH, transcript variant H (Pfrx), mRNA 
0   NM_167653.1  CG3400-RE, transcript variant E (Pfrx), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_058103.2  CG3400-RG, transcript variant G (Pfrx), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.