National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31922R-3 
 Symbol CG31922  Full Name CG31922 
 CG No CG31922  Old CG No CG31922 
 Synonyms 20K, anon-AE003587.1, CG31922 
 Accession No (Link to NCBI) NM_164408.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATTGCGACTACTGCTGTTGC 
 Primer Seq. 3'
aatctagaggtaccCTGAGTTCAAAGTCGGTTTGC 
 Predicted Fragment Size
392 
 IR fragment full Seq
0001 TATTGCGACT ACTGCTGTTG CTTTCTGAAA AACGATCTGA ATGTGAGGAA ATTGCACAAT 
0061 GGTGGTATTG CACACGCAAT TGCAAAGAGC AACTATTTGA AGCGTTACGA GGATCCCAAA 
0121 AAGATTTTGA CTGAAGAGCG GCAGAAAACT CCTTGCAAGC GATACTTTGG CAGTTACTGC 
0181 AAGTTTGAAA CATATTGCAA GTTTACCCAC TATAGTGGCG ATAATCTACG GGAACTGGAG 
0241 AAGTTGGTTC TCGCTAGAAA GAAGAGAAAA TCCCGAAAGA AAACCAACAA ATGCAAGAGA 
0301 TGGCCCTGGA AAACTCATCT GCGAAAGGGA TTACCCCCTT CCTTGCAACC CATTAACCCG 
0361 GAAAAACTCA AGCAAACCGA CTTTGAACTC AG 
 in silico PCR Fragment
0001 TATTGCGACT ACTGCTGTTG CTTTCTGAAA AACGATCTGA ATGTGAGGAA ATTGCACAAT 
0061 GGTGGTATTG CACACGCAAT TGCAAAGAGC AACTATTTGA AGCGTTACGA GGATCCCAAA 
0121 AAGATTTTGA CTGAAGAGCG GCAGAAAACT CCTTGCAAGC GATACTTTGG CAGTTACTGC 
0181 AAGTTTGAAA CATATTGCAA GTTTACCCAC TATAGTGGCG ATAATCTACG GGAACTGGAG 
0241 AAGTTGGTTC TCGCTAGAAA GAAGAGAAAA TCCCGAAAGA AAACCAACAA ATGCAAGAGA 
0301 TGGCCCTGGA AAACTCATCT GCGAAAGGGA TTACCCCCTT CCTTGCAACC CATTAACCCG 
0361 GAAAAACTCA AGCAAACCGA CTTTGAACTC AG 
 Assemble Data

31922R-3.IR_full       1   TATTGCGACTACTGCTGTTGCTTTCTGAAAAACGATCTGAATGTGAGGAAATTGCACAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     1   TATTGCGACTACTGCTGTTGCTTTCTGAAAAACGATCTGAATGTGAGGAAATTGCACAAT 60


31922R-3.IR_full       61  GGTGGTATTGCACACGCAATTGCAAAGAGCAACTATTTGAAGCGTTACGAGGATCCCAAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     61  GGTGGTATTGCACACGCAATTGCAAAGAGCAACTATTTGAAGCGTTACGAGGATCCCAAA 120


31922R-3.IR_full       121 AAGATTTTGACTGAAGAGCGGCAGAAAACTCCTTGCAAGCGATACTTTGGCAGTTACTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     121 AAGATTTTGACTGAAGAGCGGCAGAAAACTCCTTGCAAGCGATACTTTGGCAGTTACTGC 180


31922R-3.IR_full       181 AAGTTTGAAACATATTGCAAGTTTACCCACTATAGTGGCGATAATCTACGGGAACTGGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     181 AAGTTTGAAACATATTGCAAGTTTACCCACTATAGTGGCGATAATCTACGGGAACTGGAG 240


31922R-3.IR_full       241 AAGTTGGTTCTCGCTAGAAAGAAGAGAAAATCCCGAAAGAAAACCAACAAATGCAAGAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     241 AAGTTGGTTCTCGCTAGAAAGAAGAGAAAATCCCGAAAGAAAACCAACAAATGCAAGAGA 300


31922R-3.IR_full       301 TGGCCCTGGAAAACTCATCTGCGAAAGGGATTACCCCCTTCCTTGCAACCCATTAACCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31922R-3.in silico     301 TGGCCCTGGAAAACTCATCTGCGAAAGGGATTACCCCCTTCCTTGCAACCCATTAACCCG 360


31922R-3.IR_full       361 GAAAAACTCAAGCAAACCGACTTTGAACTCAG 392
                           ||||||||||||||||||||||||||||||||
31922R-3.in silico     361 GAAAAACTCAAGCAAACCGACTTTGAACTCAG 392

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   374  NM_164408.1  CG31922-RA (CG31922), mRNA 
0   10  NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   10  NM_169817.1  CG14307-RG, transcript variant G (fru), mRNA 
0   10  NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 
0   NM_142292.1  CG14897-RB, transcript variant B (CG14897), mRNA 
0   NM_143077.1  CG9996-RA (CG9996), mRNA 
0   NM_001043289.1  CG34100-RA, transcript variant A (mld), mRNA 
0   NM_001043290.1  CG34100-RB, transcript variant B (mld), mRNA 
0   NM_001043267.1  CG34118-RA (CG34118), mRNA 
0   NM_138095.1  CG13587-RA (CG13587), mRNA 
0   NM_206243.1  CG33231-RA (CG33231), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_170096.3  CG13602-RA, transcript variant A (CG13602), mRNA 
0   NM_001043284.1  CG13602-RB, transcript variant B (CG13602), mRNA 
0   NM_140538.2  CG7327-RA (Eig71Ei), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   13  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   13  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0   NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
0   NM_139925.2  CG7979-RA (CG7979), mRNA 
0   NM_136000.2  CG6453-RA (CG6453), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_141247.1  CG14660-RA (laf), mRNA 
0   NM_167575.1  CG5884-RB, transcript variant B (par-6), mRNA 
0   NM_133010.4  CG5884-RA, transcript variant A (par-6), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_132744.1  CG14411-RA, transcript variant A (CG14411), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.