National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31913R-2 
 Symbol CG31913  Full Name CG31913 
 CG No CG31913  Old CG No CG31913 
 Synonyms NEST:bs23g06, NEST:bs28e01, NEST:bs35c08, NEST:bs14h07, NEST:bs09g05, CG31913 
 Accession No (Link to NCBI) NM_164662.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGCAGCATATGCATCTGCG 
 Primer Seq. 3'
aatctagaggtaccCGGCTCCTGCTCCTTATCTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGCAGCAT ATGCATCTGC GGAGCACTCG CCTCCATCTC GGGCCTGGCC TACATGCGCT 
0061 GGCGACTTGA GGACCGTGTA CGCCAGACGG AGTTCTATCA GTTGGCCATC CANGCAGCTA 
0121 CGCCAGCACA GTGGAGCGGT CGGTCTGCTG GGCGAGCCCA TCAAGGAGTC GGGCTTTAAT 
0181 CTGTCCAACG AGAAGAATCG CTGTGACGAG GACAAGGCCC AGCTGCAGTT CCATGTCCAG 
0241 GGTCCCAAGG ACAGGGGGAC CGTCTATTTC TGGGCCTCAA ACAACCAGAA ACAGGGCTGG 
0301 CTGATCGATC GCCTGGAGCT CGAAACGAGA CAGAACCCGA ACACACGCTA CCTGCTTAAG 
0361 AAGCCCCCGA ACTACTCGCT GGTCAGCAGT GATGGTGATC CGGATCCCCC TAATGCCGAG 
0421 TCCTCCGAGG AAACCCAGCA GCCGCAGACG CCGCTCGAGC CACAGGAGCA GATGGAAATG 
0481 GAAGATAAGG AGCAGGAGCC G 
 in silico PCR Fragment
0001 TGGGCAGCAT ATGCATCTGC GGAGCACTCG CCTCCATCTC GGGCCTGGCC TACATGCGCT 
0061 GGCGACTTGA GGACCGTGTA CGCCAGACGG AGTTCTATCA GTTGGCCATC CA-GCAGCTA 
0121 CGCCAGCACA GTGGAGCGGT CGGTCTGCTG GGCGAGCCCA TCAAGGAGTC GGGCTTTAAT 
0181 CTGTCCAACG AGAAGAATCG CTGTGACGAG GACAAGGCCC AGCTGCAGTT CCATGTCCAG 
0241 GGTCCCAAGG ACAGGGGGAC CGTCTATTTC TGGGCCTCAA ACAACCAGAA ACAGGGCTGG 
0301 CTGATCGATC GCCTGGAGCT CGAAACGAGA CAGAACCCGA ACACACGCTA CCTGCTTAAG 
0361 AAGCCCCCGA ACTACTCGCT GGTCAGCAGT GATGGTGATC CGGATCCCCC TAATGCCGAG 
0421 TCCTCCGAGG AAACCCAGCA GCCGCAGACG CCGCTCGAGC CACAGGAGCA GATGGAAATG 
0481 GAAGATAAGG AGCAGGAGCC G 
 Assemble Data

31913R-2.IR_full       1   TGGGCAGCATATGCATCTGCGGAGCACTCGCCTCCATCTCGGGCCTGGCCTACATGCGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     1   TGGGCAGCATATGCATCTGCGGAGCACTCGCCTCCATCTCGGGCCTGGCCTACATGCGCT 60


31913R-2.IR_full       61  GGCGACTTGAGGACCGTGTACGCCAGACGGAGTTCTATCAGTTGGCCATCCANGCAGCTA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
31913R-2.in silico     61  GGCGACTTGAGGACCGTGTACGCCAGACGGAGTTCTATCAGTTGGCCATCCA-GCAGCTA 120


31913R-2.IR_full       121 CGCCAGCACAGTGGAGCGGTCGGTCTGCTGGGCGAGCCCATCAAGGAGTCGGGCTTTAAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     121 CGCCAGCACAGTGGAGCGGTCGGTCTGCTGGGCGAGCCCATCAAGGAGTCGGGCTTTAAT 180


31913R-2.IR_full       181 CTGTCCAACGAGAAGAATCGCTGTGACGAGGACAAGGCCCAGCTGCAGTTCCATGTCCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     181 CTGTCCAACGAGAAGAATCGCTGTGACGAGGACAAGGCCCAGCTGCAGTTCCATGTCCAG 240


31913R-2.IR_full       241 GGTCCCAAGGACAGGGGGACCGTCTATTTCTGGGCCTCAAACAACCAGAAACAGGGCTGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     241 GGTCCCAAGGACAGGGGGACCGTCTATTTCTGGGCCTCAAACAACCAGAAACAGGGCTGG 300


31913R-2.IR_full       301 CTGATCGATCGCCTGGAGCTCGAAACGAGACAGAACCCGAACACACGCTACCTGCTTAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     301 CTGATCGATCGCCTGGAGCTCGAAACGAGACAGAACCCGAACACACGCTACCTGCTTAAG 360


31913R-2.IR_full       361 AAGCCCCCGAACTACTCGCTGGTCAGCAGTGATGGTGATCCGGATCCCCCTAATGCCGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     361 AAGCCCCCGAACTACTCGCTGGTCAGCAGTGATGGTGATCCGGATCCCCCTAATGCCGAG 420


31913R-2.IR_full       421 TCCTCCGAGGAAACCCAGCAGCCGCAGACGCCGCTCGAGCCACAGGAGCAGATGGAAATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31913R-2.in silico     421 TCCTCCGAGGAAACCCAGCAGCCGCAGACGCCGCTCGAGCCACAGGAGCAGATGGAAATG 480


31913R-2.IR_full       481 GAAGATAAGGAGCAGGAGCCG 501
                           |||||||||||||||||||||
31913R-2.in silico     481 GAAGATAAGGAGCAGGAGCCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164662.1  CG31913-RA (CG31913), mRNA 
0.2   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0.2   NM_143459.1  CG1964-RA (Kul), mRNA 
0   10  22  NM_137696.1  CG15653-RA (CG15653), mRNA 
0   NM_164655.2  CG7235-RB, transcript variant B (Hsp60C), mRNA 
0   NM_135104.4  CG7235-RC, transcript variant C (Hsp60C), mRNA 
0   NM_164654.1  CG7235-RA, transcript variant A (Hsp60C), mRNA 
0   NM_138013.2  CG16787-RA (CG16787), mRNA 
0   NM_206761.1  CG33251-RA (CG33251), mRNA 
0   NM_136583.2  CG8232-RA (CG8232), mRNA 
0   NM_142268.1  CG6006-RA (CG6006), mRNA 
0   NM_057883.2  CG10117-RA (ttv), mRNA 
0   NM_136992.2  CG13325-RA (CG13325), mRNA 
0   NM_001038753.1  CG11103-RB (CG11103), mRNA 
0   NM_139389.2  CG12011-RA (CG12011), mRNA 
0   53  NM_175960.3  CG33196-RB (dp), mRNA 
0   15  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_167797.1  CG1212-RB, transcript variant B (p130CAS), mRNA 
0   NM_138158.2  CG1212-RA, transcript variant A (p130CAS), mRNA 
0   NM_057817.2  CG10637-RA, transcript variant A (Nak), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_057568.4  CG14025-RA, transcript variant A (Bsg25D), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_057818.2  CG10637-RB, transcript variant B (Nak), mRNA 
0   NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
++ 
VM
VB
++ 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.