National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31913R-1 
 Symbol CG31913  Full Name CG31913 
 CG No CG31913  Old CG No CG31913 
 Synonyms NEST:bs23g06, NEST:bs28e01, NEST:bs35c08, NEST:bs14h07, NEST:bs09g05, CG31913 
 Accession No (Link to NCBI) NM_164662.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGCAGCATATGCATCTGCGGAGCACTCGCCTCCATCTCGGGCCTGGCCTACATGCGCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     61  GGCGACTTGAGGACCGTGTACGCCAGACGGAGTTCTATCAGTTGGCCATCCA-GCAGCTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCAGCACAGTGGAGCGGTCGGTCTGCTGGGCGAGCCCATCAAGGAGTCGGGCTTTAAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGTCCAACGAGAAGAATCGCTGTGACGAGGACAAGGCCCAGCTGCAGTTCCATGTCCAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTCCCAAGGACAGGGGGACCGTCTATTTCTGGGCCTCAAACAACCAGAAACAGGGCTGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGATCGATCGCCTGGAGCTCGAAACGAGACAGAACCCGAACACACGCTACCTGCTTAAG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAGCCCCCGAACTACTCGCTGGTCAGCAGTGATGGTGATCCGGATCCCCCTAATGCCGAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCCTCCGAGGAAACCCAGCAGCCGCAGACGCCGCTCGAGCCACAGGAGCAGATGGAAATG 480

31913R-1.IR_full       481 GAAGATAAGGAGCAGGAGCCG 501
                           ||||||||||||||||||||| silico     481 GAAGATAAGGAGCAGGAGCCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164662.1  CG31913-RA (CG31913), mRNA 
0.2   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0.2   NM_143459.1  CG1964-RA (Kul), mRNA 
0   10  22  NM_137696.1  CG15653-RA (CG15653), mRNA 
0   NM_164655.2  CG7235-RB, transcript variant B (Hsp60C), mRNA 
0   NM_135104.4  CG7235-RC, transcript variant C (Hsp60C), mRNA 
0   NM_164654.1  CG7235-RA, transcript variant A (Hsp60C), mRNA 
0   NM_138013.2  CG16787-RA (CG16787), mRNA 
0   NM_206761.1  CG33251-RA (CG33251), mRNA 
0   NM_136583.2  CG8232-RA (CG8232), mRNA 
0   NM_142268.1  CG6006-RA (CG6006), mRNA 
0   NM_057883.2  CG10117-RA (ttv), mRNA 
0   NM_136992.2  CG13325-RA (CG13325), mRNA 
0   NM_001038753.1  CG11103-RB (CG11103), mRNA 
0   NM_139389.2  CG12011-RA (CG12011), mRNA 
0   53  NM_175960.3  CG33196-RB (dp), mRNA 
0   15  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_167797.1  CG1212-RB, transcript variant B (p130CAS), mRNA 
0   NM_138158.2  CG1212-RA, transcript variant A (p130CAS), mRNA 
0   NM_057817.2  CG10637-RA, transcript variant A (Nak), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_057568.4  CG14025-RA, transcript variant A (Bsg25D), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_057818.2  CG10637-RB, transcript variant B (Nak), mRNA 
0   NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.