National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31912R-1 
 Symbol CG31912  Full Name CG31912 
 CG No CG31912  Old CG No CG31912 
 Synonyms CG31912 
 Accession No (Link to NCBI) NM_164661.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGCTGACGTTGAAGTACGGA 
 Primer Seq. 3'
aatctagaggtaccGGTGTCGCCGAGGTGAACAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGCTGACGT TGAAGTACGG AGGTGGAAGT GTGCAGTTGT ATCCCGTCTT GAAGACTTCG 
0061 TGAGGCTTGG GCACAGACTT AGGAATGTGC TTGGTTCCGA AGTAGATGTG GAAGGTGGTA 
0121 TAGGCGCGCA CCAGGTGACT GCCGGGCAGA CACTCTCGCA GATACCGGAT CGAGTCCAGA 
0181 GTGGGCTGGA AGTCCGTGCC GGGCGCGTGC ATGGCAATGC TCACCGGGGC GTTCCAGCGC 
0241 TCCAACAGCG GCACCAGGTT GTCCAGGAAC GTGTAGTCCG CGTGCGTGGT GTAGGTGATC 
0301 GACTCATGGC ACTTGATGTC GCCATGCTCC GCCCGCACGT AGTTCTGCAG CACCCAGAAN 
0361 GTCGCCACGC TGCAAGGTCT GTTGGTGGTA GTCGTGGTCG AAGCAGTTGA TCAACGANTC 
0421 GCACACGCTC CTCCAGCTCC TTCTCATCGC CTGTGACTAT GTAGCCGCCG TCAGACTGGC 
0481 TATTGTTCAC CTCGGCGACA CC 
 in silico PCR Fragment
0001 GAGCTGACGT TGAAGTACGG AGGTGGAAGT GTGCAGTTGT ATCCCGTCTT GAAGACTTCG 
0061 TGAGGCTTGG GCACAGACTT AGGAATGTGC TTGGTTCCGA AGTAGATGTG GAAGGTGGTA 
0121 TAGGCGCGCA CCAGGTGACT GCCGGGCAGA CACTCTCGCA GATACCGGAT CGAGTCCAGA 
0181 GTGGGCTGGA AGTCCGTGCC GGGCGCGTGC ATGGCAATGC TCACCGGGGC GTTCCAGCGC 
0241 TCCAACAGCG GCACCAGGTT GTCCAGGAAC GTGTAGTCCG CGTGCGTGGT GTAGGTGATC 
0301 GACTCATGGC ACTTGATGTC GCCATGCTCC GCCCGCACGT AGTTCTGCAG CACCCAGAA- 
0361 GTCGCCACGC TGCAAGGTCT GTTGGTGGTA GTCGTGGTCG AAGCAGTTGA TCAACGA-TC 
0421 GCACACGCTC CTCCAGCTCC TTCTCATCGC CTGTGACTAT GTAGCCGCCG TCAGACTGGC 
0481 TATTGTTCAC CTCGGCGACA CC 
 Assemble Data

31912R-1.IR_full       1   GAGCTGACGTTGAAGTACGGAGGTGGAAGTGTGCAGTTGTATCCCGTCTTGAAGACTTCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     1   GAGCTGACGTTGAAGTACGGAGGTGGAAGTGTGCAGTTGTATCCCGTCTTGAAGACTTCG 60


31912R-1.IR_full       61  TGAGGCTTGGGCACAGACTTAGGAATGTGCTTGGTTCCGAAGTAGATGTGGAAGGTGGTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     61  TGAGGCTTGGGCACAGACTTAGGAATGTGCTTGGTTCCGAAGTAGATGTGGAAGGTGGTA 120


31912R-1.IR_full       121 TAGGCGCGCACCAGGTGACTGCCGGGCAGACACTCTCGCAGATACCGGATCGAGTCCAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     121 TAGGCGCGCACCAGGTGACTGCCGGGCAGACACTCTCGCAGATACCGGATCGAGTCCAGA 180


31912R-1.IR_full       181 GTGGGCTGGAAGTCCGTGCCGGGCGCGTGCATGGCAATGCTCACCGGGGCGTTCCAGCGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     181 GTGGGCTGGAAGTCCGTGCCGGGCGCGTGCATGGCAATGCTCACCGGGGCGTTCCAGCGC 240


31912R-1.IR_full       241 TCCAACAGCGGCACCAGGTTGTCCAGGAACGTGTAGTCCGCGTGCGTGGTGTAGGTGATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     241 TCCAACAGCGGCACCAGGTTGTCCAGGAACGTGTAGTCCGCGTGCGTGGTGTAGGTGATC 300


31912R-1.IR_full       301 GACTCATGGCACTTGATGTCGCCATGCTCCGCCCGCACGTAGTTCTGCAGCACCCAGAAN 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
31912R-1.in silico     301 GACTCATGGCACTTGATGTCGCCATGCTCCGCCCGCACGTAGTTCTGCAGCACCCAGAA- 360


31912R-1.IR_full       361 GTCGCCACGCTGCAAGGTCTGTTGGTGGTAGTCGTGGTCGAAGCAGTTGATCAACGANTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
31912R-1.in silico     361 GTCGCCACGCTGCAAGGTCTGTTGGTGGTAGTCGTGGTCGAAGCAGTTGATCAACGA-TC 420


31912R-1.IR_full       421 GCACACGCTCCTCCAGCTCCTTCTCATCGCCTGTGACTATGTAGCCGCCGTCAGACTGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31912R-1.in silico     421 GCACACGCTCCTCCAGCTCCTTCTCATCGCCTGTGACTATGTAGCCGCCGTCAGACTGGC 480


31912R-1.IR_full       481 TATTGTTCACCTCGGCGACACC 502
                           ||||||||||||||||||||||
31912R-1.in silico     481 TATTGTTCACCTCGGCGACACC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164661.1  CG31912-RA (CG31912), mRNA 
100   482  NM_164660.1  CG9171-RA, transcript variant A (CG9171), mRNA 
100   482  NM_135114.2  CG9171-RB, transcript variant B (CG9171), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_001043125.1  CG34158-RC, transcript variant C (SP2523), mRNA 
0   10  27  NM_135748.1  CG15483-RA (CG15483), mRNA 
0   NM_170491.1  CG1471-RE, transcript variant E (CDase), mRNA 
0   NM_170488.1  CG1471-RB, transcript variant B (CDase), mRNA 
0   NM_143540.1  CG1471-RA, transcript variant A (CDase), mRNA 
0   NM_170490.1  CG1471-RD, transcript variant D (CDase), mRNA 
0   NM_170489.1  CG1471-RC, transcript variant C (CDase), mRNA 
0   NM_167682.1  CG18809-RB, transcript variant B (CG18809), mRNA 
0   NM_167681.1  CG18809-RA, transcript variant A (CG18809), mRNA 
0   NM_137824.1  CG6044-RA, transcript variant A (CG6044), mRNA 
0   NM_206201.1  CG6044-RC, transcript variant C (CG6044), mRNA 
0   NM_176097.1  CG33131-RA (SCAP), mRNA 
0   NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   NM_206053.1  CG18654-RD, transcript variant D (Dgk), mRNA 
0   NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_143622.2  CG1800-RA (pasha), mRNA 
0   NM_144348.2  CG12135-RA (c12.1), mRNA 
0   NM_132495.2  CG1751-RA (Spase25), mRNA 
0   NM_142818.1  CG17623-RA (CG17623), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_169071.1  CG1411-RC, transcript variant C (CRMP), mRNA 
0   NM_169070.1  CG1411-RB, transcript variant B (CRMP), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.