National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31912R-1 
 Symbol CG31912  Full Name CG31912 
 CG No CG31912  Old CG No CG31912 
 Synonyms CG31912 
 Accession No (Link to NCBI) NM_164661.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGCTGACGTTGAAGTACGGAGGTGGAAGTGTGCAGTTGTATCCCGTCTTGAAGACTTCG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGAGGCTTGGGCACAGACTTAGGAATGTGCTTGGTTCCGAAGTAGATGTGGAAGGTGGTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TAGGCGCGCACCAGGTGACTGCCGGGCAGACACTCTCGCAGATACCGGATCGAGTCCAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGGGCTGGAAGTCCGTGCCGGGCGCGTGCATGGCAATGCTCACCGGGGCGTTCCAGCGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCAACAGCGGCACCAGGTTGTCCAGGAACGTGTAGTCCGCGTGCGTGGTGTAGGTGATC 300

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GACTCATGGCACTTGATGTCGCCATGCTCCGCCCGCACGTAGTTCTGCAGCACCCAGAA- 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     361 GTCGCCACGCTGCAAGGTCTGTTGGTGGTAGTCGTGGTCGAAGCAGTTGATCAACGA-TC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCACACGCTCCTCCAGCTCCTTCTCATCGCCTGTGACTATGTAGCCGCCGTCAGACTGGC 480

31912R-1.IR_full       481 TATTGTTCACCTCGGCGACACC 502
                           |||||||||||||||||||||| silico     481 TATTGTTCACCTCGGCGACACC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164661.1  CG31912-RA (CG31912), mRNA 
100   482  NM_164660.1  CG9171-RA, transcript variant A (CG9171), mRNA 
100   482  NM_135114.2  CG9171-RB, transcript variant B (CG9171), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_001043125.1  CG34158-RC, transcript variant C (SP2523), mRNA 
0   10  27  NM_135748.1  CG15483-RA (CG15483), mRNA 
0   NM_170491.1  CG1471-RE, transcript variant E (CDase), mRNA 
0   NM_170488.1  CG1471-RB, transcript variant B (CDase), mRNA 
0   NM_143540.1  CG1471-RA, transcript variant A (CDase), mRNA 
0   NM_170490.1  CG1471-RD, transcript variant D (CDase), mRNA 
0   NM_170489.1  CG1471-RC, transcript variant C (CDase), mRNA 
0   NM_167682.1  CG18809-RB, transcript variant B (CG18809), mRNA 
0   NM_167681.1  CG18809-RA, transcript variant A (CG18809), mRNA 
0   NM_137824.1  CG6044-RA, transcript variant A (CG6044), mRNA 
0   NM_206201.1  CG6044-RC, transcript variant C (CG6044), mRNA 
0   NM_176097.1  CG33131-RA (SCAP), mRNA 
0   NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   NM_206053.1  CG18654-RD, transcript variant D (Dgk), mRNA 
0   NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_143622.2  CG1800-RA (pasha), mRNA 
0   NM_144348.2  CG12135-RA (c12.1), mRNA 
0   NM_132495.2  CG1751-RA (Spase25), mRNA 
0   NM_142818.1  CG17623-RA (CG17623), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_169071.1  CG1411-RC, transcript variant C (CRMP), mRNA 
0   NM_169070.1  CG1411-RB, transcript variant B (CRMP), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.