National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31827R-1 
 Symbol CG31827  Full Name CG31827 
 CG No CG31827  Old CG No CG31827 
 Synonyms CG31827 
 Accession No (Link to NCBI) NM_165122.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TCCAGATGCTGTGAAAGTGCAATTTAATGTTACCGAAGGGCAAGCAAAACCAGCCGAGT 59

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCCGTGGACCATTGCCGTGATCCACAATCGCAGCTTAGTGGGTGGTGGCTCTTTAATTA 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCCCAGACATTGTGCTCACAGCTGCCCATCGGATATTCAATAAAGACGTGGAGGATATAG 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGTCAGCGCAGGAGAATGGGAGTACGGATCTGCTTTGGAAAAATATCCATTTGAAGAGG 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATTTGTGTTGAAAATGGTTATACATAAATCATTTAATTATCAGAGAGGCGCCAACAACT 299

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     301 TAGCGCTGCTCTTCCTGGATAGGGAGTTCCCACTAACATACAAGATTAACACCATTTGTT 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCCCACCCAGAAAAGATCGCTATCTTCCACTCGCTGTATAGTGGCTGGTTGGGGTAAAT 419

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     421 ATCAGTTTAGTGACACGCATTACGGAGGCGTCCTGAAGAAAATTGATTTACCTATTGTAC 479

31827R-1.IR_full       481 CCAGGCATATCTGTCAGGAT 499
                           |||||||||||||||||||| silico     481 CCAGGCATATCTGTCAGGAT 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165122.1  CG31827-RA (CG31827), mRNA 
100   482  NM_135920.1  CG18478-RA (CG18478), mRNA 
0   NM_165208.1  CG31750-RA (Gr36d), mRNA 
0   NM_206198.1  CG9294-RB, transcript variant B (CG9294), mRNA 
0   NM_137772.1  CG9294-RA, transcript variant A (CG9294), mRNA 
0   NM_057276.3  CG4178-RA (Lsp1beta), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_141998.1  CG11670-RA (CG11670), mRNA 
0   NM_142634.2  CG4241-RA, transcript variant A (att-ORFA), mRNA 
0   NM_205945.1  CG3811-RD, transcript variant D (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   NM_078699.2  CG1692-RA (mal), mRNA 
0   NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_176342.1  CG11661-RH, transcript variant H (Nc73EF), mRNA 
0   NM_168704.2  CG11661-RE, transcript variant E (Nc73EF), mRNA 
0   NM_168701.2  CG11661-RA, transcript variant A (Nc73EF), mRNA 
0   NM_168702.1  CG11661-RB, transcript variant B (Nc73EF), mRNA 
0   NM_176341.1  CG11661-RG, transcript variant G (Nc73EF), mRNA 
0   NM_176340.1  CG11661-RF, transcript variant F (Nc73EF), mRNA 
0   NM_168703.2  CG11661-RC, transcript variant C (Nc73EF), mRNA 
0   NM_141242.1  CG1126-RA (CG1126), mRNA 
0   NM_079603.2  CG5657-RA (Scgbeta), mRNA 
0   11  NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   11  NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_130539.2  CG11382-RB (CG11382), mRNA 
0   NM_139400.1  CG8001-RA (CG8001), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.