National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31826Ra-4 
 Symbol CG31826  Full Name CG31826 
 CG No CG31826  Old CG No CG31826 
 Synonyms CG13241, BG:DS09217.6, CG31826 
 Accession No (Link to NCBI) NM_165131.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCATACACGACTACTATGA 
 Primer Seq. 3'
aatctagaggtaccTTTCGTAGCCAACCATTTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCATACAC GACTACTATG AGTTCAAGCG ACGCCATCCC ACCTGGGTGG CCCGCCATCC 
0061 CATTGAGCAC TATCGTCAGC TCTTCTACGG CACCCACTGT CGCTATGTTA TGCCCCNGGC 
0121 GGATCGCAGT GGACGGGTGC TGGTCGTCTT CAAGACGGTG GATGGGTTCC AGGACTATCC 
0181 CGACTATCTG CAGAGTCTCG TCGAGATGGA CGACCTGATA TTCGAGTCGC TGNTGCTGCT 
0241 CCCGCGCGTC CAACAGAATG GGATTACGGT CATTTGTGAT CTTCAAGGGA CAAATCGAAA 
0301 TTTTCTCAGG CAATTTTCGC CGGCGTTTAT GAAGGTGGTA AACGAAAAGA ACGGAGTTCT 
0361 GCCCTTCAGT CAGCGCATCG TGCATATAAT ACAACGAGGT TTCCTGATGC ACGTAACCTC 
0421 CACTTTGTTT ATGCCCTTCA TGAACAAGGA GTTCAAAGAA AAGATCTTTA CCCACGATGG 
0481 GCGACATCTG AGCAAGCTGC GCGAAATGGT TGGCTACGAA A 
 in silico PCR Fragment
0001 GGCCATACAC GACTACTATG AGTTCAAGCG ACGCCATCCC ACCTGGGTGG CCCGTCATCC 
0061 CATTGAGCAC TATCGTCAGC TCTTCTACGG CACCCACTGT CGCTATGTTA TGCCCCAGGC 
0121 GGATCGCAGT GGACGGGTGC TGGTCGTCTT TAAGACGGTG GATGGGTTCC AGGACTATCC 
0181 CGACTATCTG CAGAGTCTCG TCGAGATGGA CGACCTGATC TTCGAGTCGC TGCTGCTGCT 
0241 CCCGCGCGTC CAACAGAATG GGATTACGGT CATTTGTGAT CTTCAAGGGC AATTTTCGCC 
0301 GGCGTTTATG AAGGTGGTAA ACGAAAAGAA CGGAGTTCTG CCCTTCAGTC AGCGCATCGT 
0361 GCATATAATA CAACGAGGTT TCCTGATGCA CGTAACCTCC ACTTTGTTTA TGCCCTTCAT 
0421 GAACAAGGAG TTCAAAGAAA AGATCTTTAC CCACGATGGG CGACATCTGA GCAAGCTGCG 
0481 CGAAATGGTT GGCTACGAAA  
 Assemble Data

31826Ra-4.IR full       1   GGCCATACACGACTACTATGAGTTCAAGCGACGCCATCCCACCTGGGTGGCCCGCCATCC 60
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
31826Ra-4.in silico     1   GGCCATACACGACTACTATGAGTTCAAGCGACGCCATCCCACCTGGGTGGCCCGTCATCC 60


31826Ra-4.IR full       61  CATTGAGCACTATCGTCAGCTCTTCTACGGCACCCACTGTCGCTATGTTATGCCCCNGGC 120
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
31826Ra-4.in silico     61  CATTGAGCACTATCGTCAGCTCTTCTACGGCACCCACTGTCGCTATGTTATGCCCCAGGC 120


31826Ra-4.IR full       121 GGATCGCAGTGGACGGGTGCTGGTCGTCTTCAAGACGGTGGATGGGTTCCAGGACTATCC 180
                            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
31826Ra-4.in silico     121 GGATCGCAGTGGACGGGTGCTGGTCGTCTTTAAGACGGTGGATGGGTTCCAGGACTATCC 180


31826Ra-4.IR full       181 CGACTATCTGCAGAGTCTCGTCGAGATGGACGACCTGATATTCGAGTCGCTGNTGCTGCT 240
                            ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||
31826Ra-4.in silico     181 CGACTATCTGCAGAGTCTCGTCGAGATGGACGACCTGATCTTCGAGTCGCTGCTGCTGCT 240


31826Ra-4.IR full       241 CCCGCGCGTCCAACAGAATGGGATTACGGTCATTTGTGATCTTCAAGGGACAAATCGAAA 300
                            |||||||||||||||||||||||||||||||||||||||||||||||||           
31826Ra-4.in silico     241 CCCGCGCGTCCAACAGAATGGGATTACGGTCATTTGTGATCTTCAAGGG----------- 300


31826Ra-4.IR full       301 TTTTCTCAGGCAATTTTCGCCGGCGTTTATGAAGGTGGTAAACGAAAAGAACGGAGTTCT 360
                                      ||||||||||||||||||||||||||||||||||||||||||||||||||
31826Ra-4.in silico     301 ----------CAATTTTCGCCGGCGTTTATGAAGGTGGTAAACGAAAAGAACGGAGTTCT 360


31826Ra-4.IR full       361 GCCCTTCAGTCAGCGCATCGTGCATATAATACAACGAGGTTTCCTGATGCACGTAACCTC 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31826Ra-4.in silico     361 GCCCTTCAGTCAGCGCATCGTGCATATAATACAACGAGGTTTCCTGATGCACGTAACCTC 420


31826Ra-4.IR full       421 CACTTTGTTTATGCCCTTCATGAACAAGGAGTTCAAAGAAAAGATCTTTACCCACGATGG 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31826Ra-4.in silico     421 CACTTTGTTTATGCCCTTCATGAACAAGGAGTTCAAAGAAAAGATCTTTACCCACGATGG 480


31826Ra-4.IR full       481 GCGACATCTGAGCAAGCTGCGCGAAATGGTTGGCTACGAAA 521
                            |||||||||||||||||||||||||||||||||||||||||
31826Ra-4.in silico     481 GCGACATCTGAGCAAGCTGCGCGAAATGGTTGGCTACGAAA 521

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165131.2  CG31826-RA (CG31826), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_078490.2  CG4528-RA (snf), mRNA 
0   NM_167395.1  CG32597-RA (l(1)G0469), mRNA 
0   11  NM_169115.1  CG2017-RB, transcript variant B (CG2017), mRNA 
0   11  NM_169116.1  CG2017-RC, transcript variant C (CG2017), mRNA 
0   11  NM_169117.1  CG2017-RD, transcript variant D (CG2017), mRNA 
0   11  NM_141346.2  CG2017-RA, transcript variant A (CG2017), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_139849.2  CG8598-RA, transcript variant A (eco), mRNA 
0   NM_168201.2  CG8598-RB, transcript variant B (eco), mRNA 
0   NM_139903.1  CG8277-RA (eIF4E-5), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_057786.3  CG7434-RA (RpL22), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_001038799.1  CG4128-RF, transcript variant F (nAcRalpha-30D), mRNA 
0   NM_205952.1  CG4128-RD, transcript variant D (nAcRalpha-30D), mRNA 
0   NM_205953.1  CG4128-RE, transcript variant E (nAcRalpha-30D), mRNA 
0   NM_164874.2  CG4128-RA, transcript variant A (nAcRalpha-30D), mRNA 
0   NM_205951.1  CG4128-RB, transcript variant B (nAcRalpha-30D), mRNA 
0   NM_169389.2  CG5270-RB, transcript variant B (CG5270), mRNA 
0   NM_135472.4  CG4128-RC, transcript variant C (nAcRalpha-30D), mRNA 
0   NM_057552.2  CG1454-RA (wdn), mRNA 
0   NM_141814.2  CG5270-RA, transcript variant A (CG5270), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.