National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31823R-4 
 Symbol CG31823  Full Name CG31823 
 CG No CG31823  Old CG No CG31823 
 Synonyms BG:DS00365.3, CG7647, CG31823 
 Accession No (Link to NCBI) NM_165138.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TATGGGCGTGTGCCCTGTGTTTTTTTTTATCACTGATCTGCGTGCAAGGACGTGTTGGTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGGGACCTGGAGTACAGGAATGGGACTATGTGGAAGTTCGGAAGGGCGCTCACCTCTTTT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTGGCTTCTATACACCACTGCCAATGTATCTCATTTCATAGAGAGGCCGCTGGTAATCT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCTGCAAGGGGGACCCGGTGTTGCATCCACCGGCAGCGGGATATTTGAGCAGCTTGGAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCATCGACATCGAGGGCAAAACGCGGGAAAGCAGTTGGTTGAAGCACGTGAATGTTCTTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGTGGACAGTCCGGTGGGCACGGGATTCGCTTACGTTGAGCATCACAGCCTCTATGCCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAACAACAGGCAGATAGCCCTCGATCTTGTCCAGTTGATGAAGCAGTTTCTTACGAAGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCCCGATTTCCGAAAGGTGCCCCTGCATATATTCTCCGAGAGCTATGGCGGAAAAATGG 480

31823R-4.IR_full       481 CTCCCGAATTCGCGCTGGAA 500
                           |||||||||||||||||||| silico     481 CTCCCGAATTCGCGCTGGAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165138.1  CG31823-RA (CG31823), mRNA 
0   11  14  NM_167839.1  CG32483-RA (CG32483), mRNA 
0   NM_136626.4  CG8029-RB, transcript variant B (CG8029), mRNA 
0   NM_165665.1  CG8029-RA, transcript variant A (CG8029), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_143533.1  CG2218-RA (CG2218), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_142268.1  CG6006-RA (CG6006), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_170049.2  CG6742-RB, transcript variant B (cenB1A), mRNA 
0   NM_079734.3  CG6742-RA, transcript variant A (cenB1A), mRNA 
0   17  23  NM_138207.2  CG3344-RA (CG3344), mRNA 
0   NM_001015405.1  CG17374-PA.3 (CG17374), mRNA 
0   NM_140566.2  CG17027-RA (CG17027), mRNA 
0   14  NM_058149.3  CG3352-RA (ft), mRNA 
0   12  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   10  NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_134535.2  CG17068-RA (CG17068), mRNA 
0   NM_136729.2  CG12909-RA (CG12909), mRNA 
0   NM_143080.1  CG13650-RA (CG13650), mRNA 
0   NM_134832.2  CG15390-RA (CG15390), mRNA 
0   NM_165612.1  CG30353-RA (CG30353), mRNA 
0   NM_140431.2  CG6451-RA (blue), mRNA 
0   NM_001031926.1  CG18170-RB, transcript variant B (CG18170), mRNA 
0   NM_166597.1  CG13551-RB, transcript variant B (CG13551), mRNA 
0   NM_166598.1  CG13551-RC, transcript variant C (CG13551), mRNA 
0   NM_001031930.1  CG33791-RA, transcript variant A (CG33791), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.