National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31823R-1 
 Symbol CG31823  Full Name CG31823 
 CG No CG31823  Old CG No CG31823 
 Synonyms BG:DS00365.3, CG7647, CG31823 
 Accession No (Link to NCBI) NM_165138.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATGGGCGTGTGCCCTGTGTT 
 Primer Seq. 3'
aatctagaggtaccTTCCAGCGCGAATTCGGGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TATGGGCGTG TGCCCTGTGT TTTTTTTTAT CACTGATCTG CGTGCAAGGA CGTGTTGGTC 
0061 TGGGACCTGG AGTACAGGAA TGGGACTATG TGGAAGTTCG GAAGGGCGCT CACCTCTTTT 
0121 ACTGGCTTCT ATACACCACT GCCAATGTAT CTCATTTCAT AGAGAGGCCG CTGGTAATCT 
0181 GGCTGCAAGG GGGACCCGGT GTTGCATCCA CCGGCAGCGG GATATTTGAG CAGCTTGGAC 
0241 CCATCGACAT CGAGGGCAAA ACGCGGGAAA GCAGTTGGTT GAAGCACGTG AATGTTCTTT 
0301 TTGTGGACAG TCCGGTGGGC ACGGGATTCG CTTACGTTGA GCATCACAGC CTCTATGCCA 
0361 GAAACAACAG GCAGATAGCC CTCGATCTTG TCCAGTTGAT GAAGCAGTTT CTTACGAAGT 
0421 ATCCCGATTT CCGAAAGGTG CCCCTGCATA TATTCTCCGA GAGCTATGGC GGAAAAATGG 
0481 CTCCCGAATT CGCGCTGGAA  
 in silico PCR Fragment
0001 TATGGGCGTG TGCCCTGTGT TTTTTTTTAT CACTGATCTG CGTGCAAGGA CGTGTTGGTC 
0061 TGGGACCTGG AGTACAGGAA TGGGACTATG TGGAAGTTCG GAAGGGCGCT CACCTCTTTT 
0121 ACTGGCTTCT ATACACCACT GCCAATGTAT CTCATTTCAT AGAGAGGCCG CTGGTAATCT 
0181 GGCTGCAAGG GGGACCCGGT GTTGCATCCA CCGGCAGCGG GATATTTGAG CAGCTTGGAC 
0241 CCATCGACAT CGAGGGCAAA ACGCGGGAAA GCAGTTGGTT GAAGCACGTG AATGTTCTTT 
0301 TTGTGGACAG TCCGGTGGGC ACGGGATTCG CTTACGTTGA GCATCACAGC CTCTATGCCA 
0361 GAAACAACAG GCAGATAGCC CTCGATCTTG TCCAGTTGAT GAAGCAGTTT CTTACGAAGT 
0421 ATCCCGATTT CCGAAAGGTG CCCCTGCATA TATTCTCCGA GAGCTATGGC GGAAAAATGG 
0481 CTCCCGAATT CGCGCTGGAA  
 Assemble Data

31823R-1.IR_full       1   TATGGGCGTGTGCCCTGTGTTTTTTTTTATCACTGATCTGCGTGCAAGGACGTGTTGGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     1   TATGGGCGTGTGCCCTGTGTTTTTTTTTATCACTGATCTGCGTGCAAGGACGTGTTGGTC 60


31823R-1.IR_full       61  TGGGACCTGGAGTACAGGAATGGGACTATGTGGAAGTTCGGAAGGGCGCTCACCTCTTTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     61  TGGGACCTGGAGTACAGGAATGGGACTATGTGGAAGTTCGGAAGGGCGCTCACCTCTTTT 120


31823R-1.IR_full       121 ACTGGCTTCTATACACCACTGCCAATGTATCTCATTTCATAGAGAGGCCGCTGGTAATCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     121 ACTGGCTTCTATACACCACTGCCAATGTATCTCATTTCATAGAGAGGCCGCTGGTAATCT 180


31823R-1.IR_full       181 GGCTGCAAGGGGGACCCGGTGTTGCATCCACCGGCAGCGGGATATTTGAGCAGCTTGGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     181 GGCTGCAAGGGGGACCCGGTGTTGCATCCACCGGCAGCGGGATATTTGAGCAGCTTGGAC 240


31823R-1.IR_full       241 CCATCGACATCGAGGGCAAAACGCGGGAAAGCAGTTGGTTGAAGCACGTGAATGTTCTTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     241 CCATCGACATCGAGGGCAAAACGCGGGAAAGCAGTTGGTTGAAGCACGTGAATGTTCTTT 300


31823R-1.IR_full       301 TTGTGGACAGTCCGGTGGGCACGGGATTCGCTTACGTTGAGCATCACAGCCTCTATGCCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     301 TTGTGGACAGTCCGGTGGGCACGGGATTCGCTTACGTTGAGCATCACAGCCTCTATGCCA 360


31823R-1.IR_full       361 GAAACAACAGGCAGATAGCCCTCGATCTTGTCCAGTTGATGAAGCAGTTTCTTACGAAGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     361 GAAACAACAGGCAGATAGCCCTCGATCTTGTCCAGTTGATGAAGCAGTTTCTTACGAAGT 420


31823R-1.IR_full       421 ATCCCGATTTCCGAAAGGTGCCCCTGCATATATTCTCCGAGAGCTATGGCGGAAAAATGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31823R-1.in silico     421 ATCCCGATTTCCGAAAGGTGCCCCTGCATATATTCTCCGAGAGCTATGGCGGAAAAATGG 480


31823R-1.IR_full       481 CTCCCGAATTCGCGCTGGAA 500
                           ||||||||||||||||||||
31823R-1.in silico     481 CTCCCGAATTCGCGCTGGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165138.1  CG31823-RA (CG31823), mRNA 
0   11  14  NM_167839.1  CG32483-RA (CG32483), mRNA 
0   NM_136626.4  CG8029-RB, transcript variant B (CG8029), mRNA 
0   NM_165665.1  CG8029-RA, transcript variant A (CG8029), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_143533.1  CG2218-RA (CG2218), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_142268.1  CG6006-RA (CG6006), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_170049.2  CG6742-RB, transcript variant B (cenB1A), mRNA 
0   NM_079734.3  CG6742-RA, transcript variant A (cenB1A), mRNA 
0   17  23  NM_138207.2  CG3344-RA (CG3344), mRNA 
0   NM_001015405.1  CG17374-PA.3 (CG17374), mRNA 
0   NM_140566.2  CG17027-RA (CG17027), mRNA 
0   14  NM_058149.3  CG3352-RA (ft), mRNA 
0   12  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   10  NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_134535.2  CG17068-RA (CG17068), mRNA 
0   NM_136729.2  CG12909-RA (CG12909), mRNA 
0   NM_143080.1  CG13650-RA (CG13650), mRNA 
0   NM_134832.2  CG15390-RA (CG15390), mRNA 
0   NM_165612.1  CG30353-RA (CG30353), mRNA 
0   NM_140431.2  CG6451-RA (blue), mRNA 
0   NM_001031926.1  CG18170-RB, transcript variant B (CG18170), mRNA 
0   NM_166597.1  CG13551-RB, transcript variant B (CG13551), mRNA 
0   NM_166598.1  CG13551-RC, transcript variant C (CG13551), mRNA 
0   NM_001031930.1  CG33791-RA, transcript variant A (CG33791), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.