National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31821R-3 
 Symbol CG31821  Full Name CG31821 
 CG No CG31821  Old CG No CG31821 
 Synonyms BG:DS00365.3, CG7647, CG31821 
 Accession No (Link to NCBI) NM_135927.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGTTATACTGATCGACCGC 
 Primer Seq. 3'
aatctagaggtaccTACCCCATCCTCGTCGATCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGTTATAC TGATCGACCG CTGGTTCTGT GGCTCCAGGG CGGACCTGGT GGCTCCTCCA 
0061 CAGCCCTGGG AAATTTCCAG GAGCTGGGAC CTGTGGACAC GAATGGTGAG CCGCGAGACG 
0121 GAAACTGGGT ACAGTACGTC AACGTGCTGT TCATTGACAA TCCCGTGGGA TCGGGGTTTA 
0181 GCTATGCGGA TAACACCAGT CTGCTGGTTA CCAACAATGA GGAGCTCATC GACGATCTGA 
0241 TTAGCTTCAT GCTGCACTTC TATAAATTGC ACAAAGAGTT CAAGAACGTC CCACTCCACA 
0301 TATTCTCGGA GAGTTATGGT GGTAAAATGG CCCCCGCCCT GGCCATTCGA CTGGCTAAAG 
0361 CCATGAGCGC CGGTGAGTTG GCGCATCCGG GAACTCTTAA GTCAGTGACT ATCGGCAATC 
0421 CTTGGATATC AACTCGGCAC ATCAGCCGCG AGCACTCCAA GTATTTGTTC GTCAATGGTT 
0481 TGATCGACGA GGATGGGGTA  
 in silico PCR Fragment
0001 GCAGTTATAC TGATCGACCG CTGGTTCTGT GGCTCCAGGG CGGACCTGGT GGCTCCTCCA 
0061 CAGCCCTGGG AAATTTCCAG GAGCTGGGAC CTGTGGACAC GAATGGTCAG CCGCGAGACG 
0121 GAAACTGGGT ACAGTACGTC AACGTGCTGT TCATTGACAA TCCCGTGGGA TCGGGGTTTA 
0181 GCTATGCGGA TAACACCAGT CTGCTGGTTA CCAACAATGA GGAGCTCATC GACGATCTGA 
0241 TTAGCTTCAT GCTGCACTTC TATAAATTGC ACAAAGAGTT CAAGAACGTC CCACTCCACA 
0301 TATTCTCGGA GAGTTATGGT GGTAAAATGG CCCCCGCCCT GGCCATTCGA CTGGCTAAAG 
0361 CCATGAGCGC CGGTGAGTTG GCGCATCCGG GAACTCTTAA GTCAGTGACT ATCGGCAATC 
0421 CTTGGATATC AACTCGGCAC ATCAGCCGCG AGCACTCCAA GTATTTGTTC GTCAATGGTT 
0481 TGATCGACGA GGATGGGGTA  
 Assemble Data

31821R-3.IR_full       1   GCAGTTATACTGATCGACCGCTGGTTCTGTGGCTCCAGGGCGGACCTGGTGGCTCCTCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     1   GCAGTTATACTGATCGACCGCTGGTTCTGTGGCTCCAGGGCGGACCTGGTGGCTCCTCCA 60


31821R-3.IR_full       61  CAGCCCTGGGAAATTTCCAGGAGCTGGGACCTGTGGACACGAATGGTGAGCCGCGAGACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
31821R-3.in silico     61  CAGCCCTGGGAAATTTCCAGGAGCTGGGACCTGTGGACACGAATGGTCAGCCGCGAGACG 120


31821R-3.IR_full       121 GAAACTGGGTACAGTACGTCAACGTGCTGTTCATTGACAATCCCGTGGGATCGGGGTTTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     121 GAAACTGGGTACAGTACGTCAACGTGCTGTTCATTGACAATCCCGTGGGATCGGGGTTTA 180


31821R-3.IR_full       181 GCTATGCGGATAACACCAGTCTGCTGGTTACCAACAATGAGGAGCTCATCGACGATCTGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     181 GCTATGCGGATAACACCAGTCTGCTGGTTACCAACAATGAGGAGCTCATCGACGATCTGA 240


31821R-3.IR_full       241 TTAGCTTCATGCTGCACTTCTATAAATTGCACAAAGAGTTCAAGAACGTCCCACTCCACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     241 TTAGCTTCATGCTGCACTTCTATAAATTGCACAAAGAGTTCAAGAACGTCCCACTCCACA 300


31821R-3.IR_full       301 TATTCTCGGAGAGTTATGGTGGTAAAATGGCCCCCGCCCTGGCCATTCGACTGGCTAAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     301 TATTCTCGGAGAGTTATGGTGGTAAAATGGCCCCCGCCCTGGCCATTCGACTGGCTAAAG 360


31821R-3.IR_full       361 CCATGAGCGCCGGTGAGTTGGCGCATCCGGGAACTCTTAAGTCAGTGACTATCGGCAATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     361 CCATGAGCGCCGGTGAGTTGGCGCATCCGGGAACTCTTAAGTCAGTGACTATCGGCAATC 420


31821R-3.IR_full       421 CTTGGATATCAACTCGGCACATCAGCCGCGAGCACTCCAAGTATTTGTTCGTCAATGGTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31821R-3.in silico     421 CTTGGATATCAACTCGGCACATCAGCCGCGAGCACTCCAAGTATTTGTTCGTCAATGGTT 480


31821R-3.IR_full       481 TGATCGACGAGGATGGGGTA 500
                           ||||||||||||||||||||
31821R-3.in silico     481 TGATCGACGAGGATGGGGTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135927.2  CG31821-RA (CG31821), mRNA 
0   19  NM_138207.2  CG3344-RA (CG3344), mRNA 
0   19  NM_169878.1  CG4572-RA, transcript variant A (CG4572), mRNA 
0   19  NM_169879.1  CG4572-RC, transcript variant C (CG4572), mRNA 
0   19  NM_142579.2  CG4572-RB, transcript variant B (CG4572), mRNA 
0   NM_137891.1  CG3695-RA (MED23), mRNA 
0   NM_079495.2  CG17947-RA (alpha-Cat), mRNA 
0   NM_135392.3  CG13096-RA (CG13096), mRNA 
0   NM_001014499.2  CG33554-RA, transcript variant A (Nipped-A), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_169486.1  CG7381-RC, transcript variant C (CG7381), mRNA 
0   NM_079187.4  CG1130-RA (scrt), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   NM_169485.1  CG7381-RB, transcript variant B (CG7381), mRNA 
0   NM_141985.1  CG7381-RA, transcript variant A (CG7381), mRNA 
0   NM_136875.2  CG17509-RA (CG17509), mRNA 
0   NM_001042908.1  CG8681-RB, transcript variant B (clumsy), mRNA 
0   NM_078886.2  CG8681-RA, transcript variant A (clumsy), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 
0   NM_135990.2  CG6860-RB, transcript variant B (CG6860), mRNA 
0   NM_165212.1  CG6860-RA, transcript variant A (CG6860), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_166672.1  CG30166-RA (CG30166), mRNA 
0   NM_001038975.1  CG6919-RB, transcript variant B (oa2), mRNA 
0   NM_142800.1  CG6919-RA, transcript variant A (oa2), mRNA 
0   NM_165428.2  CG10395-RB, transcript variant B (CG10395), mRNA 
0   NM_136323.3  CG10395-RA, transcript variant A (CG10395), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.