National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31782Ra-3 
 Symbol CG31782  Full Name CG31782 
 CG No CG31782  Old CG No CG31782 
 Synonyms CG31782,CR43671 
 Accession No (Link to NCBI) NM_165175.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCAGCCTCGCAATTTAGGCA 
 Primer Seq. 3'
aatctagaggtaccGGTATGGGCGAGTCTTCTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNNNNCNTCG CAATTTAGGC AGNNCNTTTT AACCCATTCA GAAAATAATG CCGGTAGCCA 
0061 AGAATCGAAG TATTCTGGCT CAGATTTTAG CAAGTCTAAA GAGGACACTT ACGAAAAGGA 
0121 TGACTATGAC CCTGCATCGG AATCGGACAT GCCTGCCCAA AAGCATTACG CCAAACGGCG 
0181 CCAAAAAAGT AGTGCATCCA TAACGCATTT GAAACAACAT TCACTGAATC AAGATAATAT 
0241 CAAGCCGAAA TCTAGGTTGG CTGCATCATG CAGCATAGTG CATCGTACTA CTTACATGCC 
0301 CTACAAATGT AATTACTTCC CAAAATATTT TGAAGACAAG GACTCCTATA GATTATACCT 
0361 TCGATCCCAT GGAAAGCGAT ACAAGTGTTC CCAGTGTCGA AAGACTTTTG CAAATGCAGT 
0421 GATGCGATAG ACCAAAGTGT CCGCCATCAG ATCCTCCCAA TCGGGTTGTC AAATGCCTCA 
0481 AGTGCACCAA GATGTTTCCG TTTTCCTCCA GTTGGAGTCT TCATCTACTA AGTCACGAGA 
0541 AGACTCGCCC ATACC 
 in silico PCR Fragment
0001 GGCAGCCTCG CAATTTAGGC AGCACATTTT AACCCATTCA GAAAATAATG CCGGTAGCCA 
0061 AGAATCGAAG TATTCTGGCT CAGATTTTAG CAAGTCTAAA GAGGACACTT ACGAAAAGGA 
0121 TGACTATGAC CCTGCATCGG AATCGGACAT GCCTGCCCAA AAGCATTACG CCAAACGGCG 
0181 CCAAAAAAGT AGTGCATCCA TAACGCATTT GAAACAACAT TCACTGAATC AAGATAATAT 
0241 CAAGCCGAAA TCTAGGTTGG CTGCATCATG CAGCATAGTG CATCGTACTA CTTACATGCC 
0301 CTACAAATGT AATTACTTCC CAAAATATTT TGAAGACAAG GACTCCTATA GATTATACCT 
0361 TCGATCCCAT GGAAAGCGAT ACAAGTGTTC CCAGTATCCT CCCAATCGGG TTGTCAAATG 
0421 CCTCAAGTGC ACCAAGATGT TTCCGTTTTC CTCCAGTTGG AGTCTTCATC TACTAAGTCA 
0481 CGAGAAGACT CGCCCATACC  
 Assemble Data

31782Ra-3.IR full       1   GNNNNCNTCGCAATTTAGGCAGNNCNTTTTAACCCATTCAGAAAATAATGCCGGTAGCCA 60
                            |    | |||||||||||||||  | ||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     1   GGCAGCCTCGCAATTTAGGCAGCACATTTTAACCCATTCAGAAAATAATGCCGGTAGCCA 60


31782Ra-3.IR full       61  AGAATCGAAGTATTCTGGCTCAGATTTTAGCAAGTCTAAAGAGGACACTTACGAAAAGGA 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     61  AGAATCGAAGTATTCTGGCTCAGATTTTAGCAAGTCTAAAGAGGACACTTACGAAAAGGA 120


31782Ra-3.IR full       121 TGACTATGACCCTGCATCGGAATCGGACATGCCTGCCCAAAAGCATTACGCCAAACGGCG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     121 TGACTATGACCCTGCATCGGAATCGGACATGCCTGCCCAAAAGCATTACGCCAAACGGCG 180


31782Ra-3.IR full       181 CCAAAAAAGTAGTGCATCCATAACGCATTTGAAACAACATTCACTGAATCAAGATAATAT 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     181 CCAAAAAAGTAGTGCATCCATAACGCATTTGAAACAACATTCACTGAATCAAGATAATAT 240


31782Ra-3.IR full       241 CAAGCCGAAATCTAGGTTGGCTGCATCATGCAGCATAGTGCATCGTACTACTTACATGCC 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     241 CAAGCCGAAATCTAGGTTGGCTGCATCATGCAGCATAGTGCATCGTACTACTTACATGCC 300


31782Ra-3.IR full       301 CTACAAATGTAATTACTTCCCAAAATATTTTGAAGACAAGGACTCCTATAGATTATACCT 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     301 CTACAAATGTAATTACTTCCCAAAATATTTTGAAGACAAGGACTCCTATAGATTATACCT 360


31782Ra-3.IR full       361 TCGATCCCATGGAAAGCGATACAAGTGTTCCCAGTGTCGAAAGACTTTTGCAAATGCAGT 420
                            |||||||||||||||||||||||||||||||||||                         
31782Ra-3.in silico     361 TCGATCCCATGGAAAGCGATACAAGTGTTCCCAGT------------------------- 420


31782Ra-3.IR full       421 GATGCGATAGACCAAAGTGTCCGCCATCAGATCCTCCCAATCGGGTTGTCAAATGCCTCA 480
                                                          ||||||||||||||||||||||||||||||
31782Ra-3.in silico     421 ------------------------------ATCCTCCCAATCGGGTTGTCAAATGCCTCA 480


31782Ra-3.IR full       481 AGTGCACCAAGATGTTTCCGTTTTCCTCCAGTTGGAGTCTTCATCTACTAAGTCACGAGA 540
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31782Ra-3.in silico     481 AGTGCACCAAGATGTTTCCGTTTTCCTCCAGTTGGAGTCTTCATCTACTAAGTCACGAGA 540


31782Ra-3.IR full       541 AGACTCGCCCATACC 555
                            |||||||||||||||
31782Ra-3.in silico     541 AGACTCGCCCATACC 555

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
100   482  NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_139965.2  CG7127-RA (exo70), mRNA 
0   NM_134910.2  CG18555-RA (CG18555), mRNA 
0   NM_164937.1  CG31872-RA (CG31872), mRNA 
0   NM_142603.2  CG4854-RA (CG4854), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_144409.1  CG18806-RA (CG18806), mRNA 
0   NM_137267.1  CG9068-RA (CG9068), mRNA 
0   NM_136576.2  CG8252-RA (CG8252), mRNA 
0   NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_168975.1  CG10712-RB, transcript variant B (Chro), mRNA 
0   NM_138017.1  CG3065-RA, transcript variant A (CG3065), mRNA 
0   NM_166642.1  CG3065-RB, transcript variant B (CG3065), mRNA 
0   NM_166643.1  CG3065-RC, transcript variant C (CG3065), mRNA 
0   NM_136335.2  CG1298-RA (CG1298), mRNA 
0   NM_132824.1  CG15599-RA (CG15599), mRNA 
0   NM_001015501.1  CG17629-PD.3 (CG17629), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_140405.1  CG10710-RA (CG10710), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_001031950.1  CG33700-RA (CG33700), mRNA 
0   NM_166758.2  CG2052-RB, transcript variant B (CG2052), mRNA 
0   NM_205874.1  CG2052-RA, transcript variant A (CG2052), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_132390.1  CG15306-RA (CG15306), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.