National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31782Ra-2 
 Symbol CG31782  Full Name CG31782 
 CG No CG31782  Old CG No CG31782 
 Synonyms CG31782,CR43671 
 Accession No (Link to NCBI) NM_165175.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            |    | |||||||||||||||  | |||||||||||||||||||||||||||||||||| silico     1   GGCAGCCTCGCAATTTAGGCAGCACATTTTAACCCATTCAGAAAATAATGCCGGTAGCCA 60

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGAATCGAAGTATTCTGGCTCAGATTTTAGCAAGTCTAAAGAGGACACTTACGAAAAGGA 120

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGACTATGACCCTGCATCGGAATCGGACATGCCTGCCCAAAAGCATTACGCCAAACGGCG 180

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCAAAAAAGTAGTGCATCCATAACGCATTTGAAACAACATTCACTGAATCAAGATAATAT 240

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAGCCGAAATCTAGGTTGGCTGCATCATGCAGCATAGTGCATCGTACTACTTACATGCC 300

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTACAAATGTAATTACTTCCCAAAATATTTTGAAGACAAGGACTCCTATAGATTATACCT 360

                            |||||||||||||||||||||||||||||||||||                 silico     361 TCGATCCCATGGAAAGCGATACAAGTGTTCCCAGT------------------------- 420

                                                          |||||||||||||||||||||||||||||| silico     421 ------------------------------ATCCTCCCAATCGGGTTGTCAAATGCCTCA 480

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 AGTGCACCAAGATGTTTCCGTTTTCCTCCAGTTGGAGTCTTCATCTACTAAGTCACGAGA 540

31782Ra-2.IR full       541 AGACTCGCCCATACC 555
                            ||||||||||||||| silico     541 AGACTCGCCCATACC 555

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
100   482  NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_139965.2  CG7127-RA (exo70), mRNA 
0   NM_134910.2  CG18555-RA (CG18555), mRNA 
0   NM_164937.1  CG31872-RA (CG31872), mRNA 
0   NM_142603.2  CG4854-RA (CG4854), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_144409.1  CG18806-RA (CG18806), mRNA 
0   NM_137267.1  CG9068-RA (CG9068), mRNA 
0   NM_136576.2  CG8252-RA (CG8252), mRNA 
0   NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_168975.1  CG10712-RB, transcript variant B (Chro), mRNA 
0   NM_138017.1  CG3065-RA, transcript variant A (CG3065), mRNA 
0   NM_166642.1  CG3065-RB, transcript variant B (CG3065), mRNA 
0   NM_166643.1  CG3065-RC, transcript variant C (CG3065), mRNA 
0   NM_136335.2  CG1298-RA (CG1298), mRNA 
0   NM_132824.1  CG15599-RA (CG15599), mRNA 
0   NM_001015501.1  CG17629-PD.3 (CG17629), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_140405.1  CG10710-RA (CG10710), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_001031950.1  CG33700-RA (CG33700), mRNA 
0   NM_166758.2  CG2052-RB, transcript variant B (CG2052), mRNA 
0   NM_205874.1  CG2052-RA, transcript variant A (CG2052), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_132390.1  CG15306-RA (CG15306), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.