National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31780R-3 
 Symbol CG31780  Full Name CG31780 
 CG No CG31780  Old CG No CG31780 
 Synonyms CG31780 
 Accession No (Link to NCBI) NM_165119.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCTTGCTGGATGCCAGAAC 
 Primer Seq. 3'
aatctagaggtaccGCTCACCGCCTGCGCACATTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ggCCTNTGCA TGGATGCCAG AACCAGCAGC TATGTGGCCG GTgGNGCCCT CATCGCTCCA 
0061 CATGTAGTGA TCACGGCCAG GCAAAGAACC GAAAACATGA CCGCAAGCCA GCTTGTTGTG 
0121 CGAGCTGGCG ANATGGGACT TCAGCACCAA AACCGAGCAG CTTCCTTCTG TGGACGTTCC 
0181 TATTCGGTCA ATTGTCCGTC ATCNCTGGCT TCAATTTAGA GAATGGGGCC AATAATGTGG 
0241 CCCTTGTGTT TCTTCGCAGA TCGCTCACCA GCTCGCGCCA CATAAATCCA ATATGTATGC 
0301 CGTCGGCTCC AAAGAATTTT GACTTTAGCC GGTGCATATT TACGGGCTGG GGAAAGAATT 
0361 CCTTTGACGA TCCCTCCTAT ATGAATGTCC TGAAAAAAAT ATCATTGCCG GTGGTCCAAA 
0421 GGCGTACCTG TGAGCAGCAA CTTCGCCTCT ATTACGGNAA ACGATTTTGA ACTGGACAAC 
0481 AGCTTTAATG TGCGCAGGCG GTGNGN 
 in silico PCR Fragment
0001 GGCCT-TGC- TGGATGCCAG AACCAGCAGC TATGTGGCCG GTGGCGCCCT CATCGCTCCA 
0061 CATGTAGTGA TCACGGCCAG GCAAAGAACC GAAAACATGA CCGCAAGCCA GCTTGTTGTG 
0121 CGAGCTGGCG A-ATGGGACT TCAGCACCAA AACCGAGCAG CTTCCTTCTG TGGACGTTCC 
0181 TATTCGGTCA ATTGTCCGTC ATC-CTGGCT TCAATTTAGA GAATGGGGCC AATAATGTGG 
0241 CCCTTGTGTT TCTTCGCAGA TCGCTCACCA GCTCGCGCCA CATAAATCCA ATATGTATGC 
0301 CGTCGGCTCC AAAGAATTTT GACTTTAGCC GGTGCATATT TACGGGCTGG GGAAAGAATT 
0361 CCTTTGACGA TCCCTCCTAT ATGAATGTCC TGAAAAAAAT ATCATTGCCG GTGGTCCAAA 
0421 GGCGTACCTG TGAGCAGCAA CTTCGCCTCT ATTACGG-AA ACGATTTTGA ACTGGACAAC 
0481 AGC-TTAATG TGCGCAGGCG GTGAGC 
 Assemble Data

31780R-3.IR_full       1   GGCCTNTGCATGGATGCCAGAACCAGCAGCTATGTGGCCGGTGGNGCCCTCATCGCTCCA 60
                           ||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||
31780R-3.in silico     1   GGCCT-TGC-TGGATGCCAGAACCAGCAGCTATGTGGCCGGTGGCGCCCTCATCGCTCCA 60


31780R-3.IR_full       61  CATGTAGTGATCACGGCCAGGCAAAGAACCGAAAACATGACCGCAAGCCAGCTTGTTGTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31780R-3.in silico     61  CATGTAGTGATCACGGCCAGGCAAAGAACCGAAAACATGACCGCAAGCCAGCTTGTTGTG 120


31780R-3.IR_full       121 CGAGCTGGCGANATGGGACTTCAGCACCAAAACCGAGCAGCTTCCTTCTGTGGACGTTCC 180
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
31780R-3.in silico     121 CGAGCTGGCGA-ATGGGACTTCAGCACCAAAACCGAGCAGCTTCCTTCTGTGGACGTTCC 180


31780R-3.IR_full       181 TATTCGGTCAATTGTCCGTCATCNCTGGCTTCAATTTAGAGAATGGGGCCAATAATGTGG 240
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
31780R-3.in silico     181 TATTCGGTCAATTGTCCGTCATC-CTGGCTTCAATTTAGAGAATGGGGCCAATAATGTGG 240


31780R-3.IR_full       241 CCCTTGTGTTTCTTCGCAGATCGCTCACCAGCTCGCGCCACATAAATCCAATATGTATGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31780R-3.in silico     241 CCCTTGTGTTTCTTCGCAGATCGCTCACCAGCTCGCGCCACATAAATCCAATATGTATGC 300


31780R-3.IR_full       301 CGTCGGCTCCAAAGAATTTTGACTTTAGCCGGTGCATATTTACGGGCTGGGGAAAGAATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31780R-3.in silico     301 CGTCGGCTCCAAAGAATTTTGACTTTAGCCGGTGCATATTTACGGGCTGGGGAAAGAATT 360


31780R-3.IR_full       361 CCTTTGACGATCCCTCCTATATGAATGTCCTGAAAAAAATATCATTGCCGGTGGTCCAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31780R-3.in silico     361 CCTTTGACGATCCCTCCTATATGAATGTCCTGAAAAAAATATCATTGCCGGTGGTCCAAA 420


31780R-3.IR_full       421 GGCGTACCTGTGAGCAGCAACTTCGCCTCTATTACGGNAAACGATTTTGAACTGGACAAC 480
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
31780R-3.in silico     421 GGCGTACCTGTGAGCAGCAACTTCGCCTCTATTACGG-AAACGATTTTGAACTGGACAAC 480


31780R-3.IR_full       481 AGCTTTAATGTGCGCAGGCGGTGNGN 506
                           ||| ||||||||||||||||||| | 
31780R-3.in silico     481 AGC-TTAATGTGCGCAGGCGGTGAGC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165119.1  CG31780-RB (CG31780), mRNA 
100   482  NM_135919.1  CG18477-RA (CG18477), mRNA 
0.41   NM_134801.1  CG4259-RA (CG4259), mRNA 
0.41   NM_206072.1  CG33478-RA, transcript variant A (Or46a), mRNA 
0   13  NM_135530.2  CG5390-RA (CG5390), mRNA 
0   NM_142301.1  CG14889-RA (CG14889), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   24  17  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   24  17  NM_135929.2  CG4793-RB, transcript variant B (CG4793), mRNA 
0   NM_001031898.1  CG33935-RA, transcript variant A (mei-217), mRNA 
0   NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
0   NM_167557.2  CG8923-RB, transcript variant B (mei-218), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_166029.1  CG30482-RA (CG30482), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   10  NM_134878.1  CG3117-RA (CG3117), mRNA 
0   NM_001015243.1  CG40460-PC.3 (CG40460), mRNA 
0   NM_001015245.1  CG40460-PF.3 (CG40460), partial mRNA 
0   NM_001015247.1  CG40460-PJ.3 (CG40460), mRNA 
0   NM_001015246.1  CG40460-PI.3 (CG40460), mRNA 
0   NM_001015248.1  CG40460-PE.3 (CG40460), mRNA 
0   NM_001015249.1  CG40460-PH.3 (CG40460), mRNA 
0   NM_001015251.1  CG40460-PB.3 (CG40460), mRNA 
0   NM_001015250.1  CG40460-PK.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.