National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3176R-2 
 Symbol CG3176  Full Name CG3176 
 CG No CG3176  Old CG No CG3176 
 Synonyms BcDNA:RH59219, CG3176 
 Accession No (Link to NCBI) NM_130486.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTCGATGGCGAAACCGGCA 
 Primer Seq. 3'
aatctagaggtaccCTAGCTGAGGAACATCTGGCA 
 Predicted Fragment Size
362 
 IR fragment full Seq
0001 TTTTCGATGG CGAAACCGGC AATGGGCAAG GTCAGGGCCA GAATACCCTG AATCCATTGG 
0061 GGCCAGGCCA GGAGGAGCCC GCCCTATGCG AGCAGTACTA TCTGCTGGGC GATGGTTCCA 
0121 TCATTCTGCG CAACCATTCC ATCGACTTGT CGAATCCGCC CCTGAAATCG CGCTGCTGCC 
0181 AGCTCCCAAC ACTCATCCAC GACATATGCG TCAACTGCGT GATGGATCTC TGCGAGGAGT 
0241 GTGGCTANCT CCTGCGGCGA GTGCGCCAAG TTTATTTGCC GCAACTGCGT GACTTTATTT 
0301 GGTAATCGAA TTGAAGAAGA GGAGGATCCG CTGTGCGAGC NACTGCCAGA TGTTCCTCAG 
0361 CTAG 
 in silico PCR Fragment
0001 TTTTCGATGG CGAAACCGGC AATGGGCAAG GTCAGGGCCA GAATACCCTG AATCCATTGG 
0061 GGCCAGGCCA GGAGGAGCCC GCCCTATGCG AGCAGTACTA TCTGCTGGGC GATGGTTCCA 
0121 TCATTCTGCG CAACCATTCC ATCGACTTGT CGAATCCGCC CCTGAAATCG CGCTGCTGCC 
0181 AGCTCCCAAC ACTCATCCAC GACATATGCG TCAACTGCGT GATGGATCTC TGCGAGGAGT 
0241 GTGGCTA-CT CCTGCGGCGA GTGCGCCAAG TTTATTTGCC GCAACTGCGT GACTTTATTT 
0301 GGTAATCGAA TTGAAGAAGA GGAGGATCCG CTGTGCGAGC -ACTGCCAGA TGTTCCTCAG 
0361 CTAG 
 Assemble Data

3176R-2.IR_full       1   TTTTCGATGGCGAAACCGGCAATGGGCAAGGTCAGGGCCAGAATACCCTGAATCCATTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3176R-2.in silico     1   TTTTCGATGGCGAAACCGGCAATGGGCAAGGTCAGGGCCAGAATACCCTGAATCCATTGG 60


3176R-2.IR_full       61  GGCCAGGCCAGGAGGAGCCCGCCCTATGCGAGCAGTACTATCTGCTGGGCGATGGTTCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3176R-2.in silico     61  GGCCAGGCCAGGAGGAGCCCGCCCTATGCGAGCAGTACTATCTGCTGGGCGATGGTTCCA 120


3176R-2.IR_full       121 TCATTCTGCGCAACCATTCCATCGACTTGTCGAATCCGCCCCTGAAATCGCGCTGCTGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3176R-2.in silico     121 TCATTCTGCGCAACCATTCCATCGACTTGTCGAATCCGCCCCTGAAATCGCGCTGCTGCC 180


3176R-2.IR_full       181 AGCTCCCAACACTCATCCACGACATATGCGTCAACTGCGTGATGGATCTCTGCGAGGAGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3176R-2.in silico     181 AGCTCCCAACACTCATCCACGACATATGCGTCAACTGCGTGATGGATCTCTGCGAGGAGT 240


3176R-2.IR_full       241 GTGGCTANCTCCTGCGGCGAGTGCGCCAAGTTTATTTGCCGCAACTGCGTGACTTTATTT 300
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
3176R-2.in silico     241 GTGGCTA-CTCCTGCGGCGAGTGCGCCAAGTTTATTTGCCGCAACTGCGTGACTTTATTT 300


3176R-2.IR_full       301 GGTAATCGAATTGAAGAAGAGGAGGATCCGCTGTGCGAGCNACTGCCAGATGTTCCTCAG 360
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
3176R-2.in silico     301 GGTAATCGAATTGAAGAAGAGGAGGATCCGCTGTGCGAGC-ACTGCCAGATGTTCCTCAG 360


3176R-2.IR_full       361 CTAG 364
                          ||||
3176R-2.in silico     361 CTAG 364

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   344  NM_130486.1  CG3176-RA (CG3176), mRNA 
86.04   296  45  NM_166842.1  CG32817-RA (CG32817), mRNA 
27.32   94  87  72  50  NM_130484.1  CG13373-RA (CG13373), mRNA 
26.74   92  21  NM_166843.3  CG18166-RA, transcript variant A (CG18166), mRNA 
0.29   NM_141431.1  CG1105-RA (CG1105), mRNA 
0   NM_168459.1  CG32089-RA (Vha16-2), mRNA 
0   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_001032023.1  CG11779-RC, transcript variant C (CG11779), mRNA 
0   NM_169849.1  CG11779-RB, transcript variant B (CG11779), mRNA 
0   NM_142529.3  CG11779-RA, transcript variant A (CG11779), mRNA 
0   NM_001032022.1  CG11779-RD, transcript variant D (CG11779), mRNA 
0   NM_205955.3  CG33301-RA (CG33301), mRNA 
0   NM_167509.1  CG18734-RE, transcript variant E (Fur2), mRNA 
0   NM_167507.1  CG18734-RB, transcript variant B (Fur2), mRNA 
0   NM_167510.1  CG18734-RF, transcript variant F (Fur2), mRNA 
0   NM_167508.1  CG18734-RC, transcript variant C (Fur2), mRNA 
0   NM_206763.1  CG18734-RG, transcript variant G (Fur2), mRNA 
0   NM_078644.2  CG18734-RD, transcript variant D (Fur2), mRNA 
0   NM_167506.1  CG18734-RA, transcript variant A (Fur2), mRNA 
0   NM_167303.1  CG4139-RA, transcript variant A (Karl), mRNA 
0   NM_132520.2  CG4139-RB, transcript variant B (Karl), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_057691.3  CG4654-RA, transcript variant A (Dp), mRNA 
0   NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057867.2  CG8808-RA (Pdk), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_165403.1  CG31601-RA (CG31601), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.