National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31769R-1 
 Symbol CG31769  Full Name CG31769 
 CG No CG31769  Old CG No CG31769 
 Synonyms BcDNA:RH26533, CG31769 
 Accession No (Link to NCBI) NM_165083.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAGGCATTGGAACGTGCTTG 
 Primer Seq. 3'
aatctagaggtaccGTGTGTGGATGTTGGATTTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTAgGCATTG GAACGTGCTT GAAACAGTCG TAAATAATAT GCGGATCACT AAAAGGCCGT 
0061 GGATAGTTAC AAAAACTAAA CCGTGCGGTG AGGTGATTAG GGAAACCTAC ATGTTGAGCC 
0121 CCAACGAAGA GGAACTCATA AGGAGAACGG AAGTCATGCT CTTGCAAGCT CAAGGAAAAT 
0181 TGGAATGTTT ACTTAGCCAG TTGCAATCGA CATTACGACT TGGCAGTGTC TACAATAATC 
0241 CCTTTCTAAA CCCGGTCGGT TTTGGTTTTC CTGACTATAA CGTCCTTCAA AATTTTCCGT 
0301 TTATCCCGGA ATTGAAGCCG CAACGTATTC CTCCCGAAGA AGGTCGCAGT AATGAAAATA 
0361 ATCCTCGCCG AGAAGATCCG CGGGTAAATG AGCAGGATGC GTGGAATTTA CGCCCTCAAG 
0421 ACGTCCCCAA AGANAATGAA CACATTCCNC NATAGTGAAT CGGATAGTGA TAGATGGCTG 
0481 CCAAATCCAA CATCCNCACA C 
 in silico PCR Fragment
0001 CTAGGCATTG GAACGTGCTT GAAACAGTCG TAAATAATAT GCGGATCACT AAAAGGCCGT 
0061 GGATAGTTAC AAAAACTAAA CCGTGCGGTG AGGTGATTAG GGAAACCTAC ATGTTGAGCC 
0121 CCAACGAAGA GGAACTCATA AGGAGAACGG AAGTCATGCT CTTGCAAGCT CAAGGAAAAT 
0181 TGGAATGTTT ACTTAGCCAG TTTCAACCGA CATTACGACT TGGCAGTGTC TACAATAATC 
0241 CCTTTCTAAA CCCGGTCGGT TTTGGTTTTC CTGACTATAA CGTCTTCCAA AATTTTCCGT 
0301 TTATCCCGGA ATTTAAGCCG CAACGTATTC CTCCCGAAGA AGATCGCAGT AATGAAAATA 
0361 ATCCTCGCCG AGAAGATCCG CGGGTAAATG AGCAGGATGC GTGGAATTTA CGCCCTCAAG 
0421 ACGTCCCCAA AGAAAATGAA CACATTCC-C AATAGTGAAT CGGATAGTGA TAGATGGCTG 
0481 CCAAATCCAA CATCCACACA C 
 Assemble Data

31769R-1.IR_full       1   CTAGGCATTGGAACGTGCTTGAAACAGTCGTAAATAATATGCGGATCACTAAAAGGCCGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31769R-1.in silico     1   CTAGGCATTGGAACGTGCTTGAAACAGTCGTAAATAATATGCGGATCACTAAAAGGCCGT 60


31769R-1.IR_full       61  GGATAGTTACAAAAACTAAACCGTGCGGTGAGGTGATTAGGGAAACCTACATGTTGAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31769R-1.in silico     61  GGATAGTTACAAAAACTAAACCGTGCGGTGAGGTGATTAGGGAAACCTACATGTTGAGCC 120


31769R-1.IR_full       121 CCAACGAAGAGGAACTCATAAGGAGAACGGAAGTCATGCTCTTGCAAGCTCAAGGAAAAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31769R-1.in silico     121 CCAACGAAGAGGAACTCATAAGGAGAACGGAAGTCATGCTCTTGCAAGCTCAAGGAAAAT 180


31769R-1.IR_full       181 TGGAATGTTTACTTAGCCAGTTGCAATCGACATTACGACTTGGCAGTGTCTACAATAATC 240
                           |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||
31769R-1.in silico     181 TGGAATGTTTACTTAGCCAGTTTCAACCGACATTACGACTTGGCAGTGTCTACAATAATC 240


31769R-1.IR_full       241 CCTTTCTAAACCCGGTCGGTTTTGGTTTTCCTGACTATAACGTCCTTCAAAATTTTCCGT 300
                           |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
31769R-1.in silico     241 CCTTTCTAAACCCGGTCGGTTTTGGTTTTCCTGACTATAACGTCTTCCAAAATTTTCCGT 300


31769R-1.IR_full       301 TTATCCCGGAATTGAAGCCGCAACGTATTCCTCCCGAAGAAGGTCGCAGTAATGAAAATA 360
                           ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||
31769R-1.in silico     301 TTATCCCGGAATTTAAGCCGCAACGTATTCCTCCCGAAGAAGATCGCAGTAATGAAAATA 360


31769R-1.IR_full       361 ATCCTCGCCGAGAAGATCCGCGGGTAAATGAGCAGGATGCGTGGAATTTACGCCCTCAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31769R-1.in silico     361 ATCCTCGCCGAGAAGATCCGCGGGTAAATGAGCAGGATGCGTGGAATTTACGCCCTCAAG 420


31769R-1.IR_full       421 ACGTCCCCAAAGANAATGAACACATTCCNCNATAGTGAATCGGATAGTGATAGATGGCTG 480
                           ||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||
31769R-1.in silico     421 ACGTCCCCAAAGAAAATGAACACATTCC-CAATAGTGAATCGGATAGTGATAGATGGCTG 480


31769R-1.IR_full       481 CCAAATCCAACATCCNCACAC 501
                           ||||||||||||||| |||||
31769R-1.in silico     481 CCAAATCCAACATCCACACAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165083.2  CG31769-RA (CG31769), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_136815.1  CG13222-RA (CG13222), mRNA 
0   NM_080152.2  CG5092-RA (Tor), mRNA 
0   NM_079743.2  CG5163-RA (TfIIA-S), mRNA 
0   NM_167261.1  CG32670-RA (CG32670), mRNA 
0   NR_001945.1  CR32489, miscRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   NM_167260.1  CG32671-RA (CG32671), mRNA 
0   NM_132399.1  CG2885-RA (RabX2), mRNA 
0   NM_132414.1  CG9807-RA (CG9807), mRNA 
0   NM_167238.1  CG32673-RA (CG32673), mRNA 
0   NM_167237.1  CG32678-RA (Rab9D), mRNA 
0   NM_144357.2  CG13475-RA (HGTX), mRNA 
0   NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   NM_175956.1  CG33003-RA (CG33003), mRNA 
0   NM_166128.1  CG18255-RG, transcript variant G (Strn-Mlck), mRNA 
0   NM_169973.1  CG31173-RA (Gr93c), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_137227.2  CG8315-RA (CG8315), mRNA 
0   NM_079030.2  CG18255-RB, transcript variant B (Strn-Mlck), mRNA 
0   NM_137905.2  CG30194-RB, transcript variant B (CG30194), mRNA 
0   NM_206203.1  CG30194-RC, transcript variant C (CG30194), mRNA 
0   NM_206204.1  CG30194-RD, transcript variant D (CG30194), mRNA 
0   NM_165368.1  CG18362-RE, transcript variant E (Mio), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.